918 resultados para RANDOM AMPLIFICATION
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Markovian algorithms for estimating the global maximum or minimum of real valued functions defined on some domain Omega subset of R-d are presented. Conditions on the search schemes that preserve the asymptotic distribution are derived. Global and local search schemes satisfying these conditions are analysed and shown to yield sharper confidence intervals when compared to the i.i.d. case.
Resumo:
Paracoccidioides brasiliensis isolates are not homogeneous in their patterns of pathogenicity in animals and adhesion to epithelial cells. During this investigation, genotypic differences were observed between two samples of P. brasiliensis strain 18 yeast phase (Pbl 8) previously cultured many times, one taken before (Pb18a) and the other after (Pb18b) animal inoculation. Random amplified polymorphic DNA analysis using the primer OPJ4 distinguished Pb18b from Pbl Ba by one 308 bp DNA fragment, which after cloning and sequencing was shown to encode a polypeptide sequence homologous to the protein beta-adaptin. It is suggested, by comparison to other micro-organisms, that this protein might play an important role in the virulence of P. brasiliensis. This result demonstrates the influence of in vitro subculturing on the genotype of this organism.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Sixty-three Paracoccidioides brasiliensis isolates obtained from three nine-banded armadillos (Dasypus novem-cinctus), one Amazonian armadillo's and 19 clinical isolates were compared by random amplified polymorphic DNA analysis with the primer OPG-19. The isolates were divided into three major clusters, I, II and III. Coincidences between human and armadillo isolates were observed in clusters I and II. Cluster III consisted only of armadillos' isolates. The results suggested that (I) humans may acquire P. brasiliensis infection by contact with armadillo's environment, (II) there may be P. brasiliensis genotypes peculiar to the animal, and (III) individual armadillos may be infected with P brasiliensis cells with different genotypes.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
This study investigated the effects of 670 nm laser, at different fluences, on the viability of skin flap in rats. One hundred male animals were used. The animals were divided into control group; group treated with 3 J/cm(2); group treated with 6 J/cm(2); group treated with 12 J/cm(2) and group treated with 24 J/cm(2). The skin flap was made on the backs of all animals studied, with a plastic sheet interposed between the flap and the donor site. Laser irradiation was done immediately after the surgery and on days 1, 2, 3 and 4 after surgery. The percentage of necrosis of the flap was calculated at the 7th postoperative day. Additionally, a sample of each flap was collected to enable us to count the blood vessels. Treated animals showed a statistically significant smaller area of necrosis than did the control group. The necrosis in the treated groups was 41.82% (group 2), 36.51% (group 3), 29.45% (group 4) and 20.37% (group 5). We also demonstrated that laser irradiation at 670 nm, at all doses used, had a stimulatory effect on angiogenesis. Our study showed that the 670 nm laser was efficient to increase the viability of the skin flap, at all fluences used, with a tendency of reaching better results at higher doses.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fifteen polymorphic microsatellite markers were isolated and characterized in two species of Bromeliaceae: Vriesea gigantea and Alcantarea imperialis. The number of alleles observed for each locus ranged from three to 16. The loci will be used for studies of the genetic structure of natural populations, reproductive biology, and evolutionary relationships among and within these genera. A cross-amplification test in 22 taxa suggests that the markers will be useful for similar applications in numerous other bromeliad species.