928 resultados para Foundation colony
Resumo:
Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
The effect of foundation embedment on settlement calculation is a widely researched topic in which there is no scientific consensus regarding the magnitude of settlement reduction. In this paper, a non-linear three dimensional Finite Element analysis has been performed with the aim of evaluating the aforementioned effect. For this purpose, 1800 models were run considering different variables, such as the depth and dimensions of the foundation and the Young’s modulus and Poisson’s ratio of the soil. The settlements from models with foundations at surface level and at depth were then compared and the relationship between them established. The statistical analysis of this data allowed two new expressions, with a mean maximum error of 1.80%, for the embedment influence factor of a foundation to be proposed and these to be compared with commonly used corrections. The proposed equations were validated by comparing the settlements calculated with the proposed influence factors and the true settlements measured in several real foundations. From the comprehensive study of all modelled cases, an improved approach, when compared to those proposed by other authors, for the calculation of the true elastic settlements of an embedded foundation is proposed.
Resumo:
Bracketed annotation made by John Langdon Sibley in Feb. 1842: "The books on this & the three succeeding pages, I find on examination, to have been given by Gov. Bernard." On the fourth page, presumably also in 1842, Sibley wrote: "This is a list of donations by Gov. Bernard, & not by Hollis."
Resumo:
A motion that the case not be tried in Suffolk County, on the grounds that the judges and jurors were residents of the colony. Pratt was attorney to Paxton, an attorney and commissioner of customs, who had incurred a debt to the Colony.
Resumo:
Autograph copy, signed.
Resumo:
This layer is a georeferenced raster image of the historic paper map entitled: Old Colony Railroad and connections, [by] E.N. Winslow, del. It was published in 1873. Covers southeastern Massachusetts, from Boston to Cape Cod. The image inside the map neatline is georeferenced to the surface of the earth and fit to the Massachusetts State Plane Coordinate System, Mainland Zone (in Feet) (Fipszone 2001). All map collar and inset information is also available as part of the raster image, including any inset maps, profiles, statistical tables, directories, text, illustrations, or other information associated with the principal map. This map shows features such as roads, railroads, railroad stations, drainage, town boundaries and more. Includes two illustrations. This layer is part of a selection of digitally scanned and georeferenced historic maps of Massachusetts from the Harvard Map Collection. These maps typically portray both natural and manmade features. The selection represents a range of regions, originators, ground condition dates (1755-1922), scales, and purposes. The digitized selection includes maps of: the state, Massachusetts counties, town surveys, coastal features, real property, parks, cemeteries, railroads, roads, public works projects, etc.
Resumo:
[Introduction.] This paper discusses the uncertain future of Member State BITs with third countries in the light of the developing EU investment policy. The question will be examined on the basis of the proposed Regulation establishing transitional arrangements for bilateral investment agreements between Member States and third countries presented by the Commission on 7 July 20101 and the European Parliament’s Position adopted at first reading on 10 May 2011.2 The proposed Regulation and the Commission Communication of the same day are meant to be the “first steps in the development of an EU international investment policy”.3 The first chapters present the legal framework relevant for this question and its evolution to better understand the particular challenges of this transition process. The second chapter examines the relationship of EU law and investment law, with a brief introduction of the notion of investment law and the scope of the EU’s new investment competence. The third chapter outlines the legal framework for the continuation and termination of treaties under international and EU law. The fourth chapter concerns BITs, first covering the particular nature of BITs and then the CJEU’s judgments in the BIT Cases of 2009. The fifth chapter consists of a step by step analysis of the different provisions of the proposed Regulation.