Adaptive tracking of EEG oscillations.

Neuronal oscillations are an important aspect of EEG recordings. These oscillations are supposed to be involved in several cognitive mechanisms. For instance, oscillatory activity is considered a key component for the top-down control of perception. However, measuring this activity and its influence requires precise extraction of frequency components. This processing is not straightforward. Particularly, difficulties with extracting oscillations arise due to their time-varying characteristics. Moreover, when phase information is needed, it is of the utmost importance to extract narrow-band signals. This paper presents a novel method using adaptive filters for tracking and extracting these time-varying oscillations. This scheme is designed to maximize the oscillatory behavior at the output of the adaptive filter. It is then capable of tracking an oscillation and describing its temporal evolution even during low amplitude time segments. Moreover, this method can be extended in order to track several oscillations simultaneously and to use multiple signals. These two extensions are particularly relevant in the framework of EEG data processing, where oscillations are active at the same time in different frequency bands and signals are recorded with multiple sensors. The presented tracking scheme is first tested with synthetic signals in order to highlight its capabilities. Then it is applied to data recorded during a visual shape discrimination experiment for assessing its usefulness during EEG processing and in detecting functionally relevant changes. This method is an interesting additional processing step for providing alternative information compared to classical time-frequency analyses and for improving the detection and analysis of cross-frequency couplings.

Carotid-subclavian arteries Index (CSI), a new echocardiographic index to recognize coarctation of the aorta in neonates and infants

Introduction: Coarctation of the aorta is a common congenital heart malformation. Mode of diagnosis changed from clinically to almost exclusively by echocardiogram and MRI. We claim to find a new echocardiographic index, based on simple and reliable morphologic measurements, to facilitate the diagnosis of aortic coarctation in the newborn.We reproduce the same procedure for older child to validate this new index. Material and Methods: We reviewed echocardiographic studies of 47 neonates with diagnosis of coarctation who underwent cardiac surgery between January 1997 and February 2003 and compared them with a matched control group. We measured 12 different sites of the aorta, aortic arch and the great vessels on the echocardiographic bands. In a second time we reviewed 23 infants for the same measurements and compare them with a matched control group. Results: 47 neonates with coarctation were analysed, age 11.8 _ 10 days,weight 3.0 _ 0.6 kg, body surface 0.20 _ 0.02m2. The control group was of 16 newborns aged 15.8 _ 10 days,weight 3.2 _ 0.9 kg and body surface 0.20 _ 0.04m2. A significant difference was noted in many morphologic measurement between the both groups, the most significant being the distance between the left carotid artery and the left subclavian artery (coarctation vs control: 7.3 _ 3mm vs 2.4 _ 0.8mm, p _ 0.0001). We then defined a new index, the carotid-subclavian arteries index (CSI) as the diameter of the distal tranverse aortic arch divided to the distance left carotid artery to left subclavian artery being also significaly different (coarctation vs control: 0.76 _ 0.86 vs 2.95 _ 1.24, p _ 0.0001). With the cutoff value of this index of 1.5 the sensitivity for aortic coarctation was 98% and the specificity of 92%. In an older group of infant with coarctation (16 patients) we apply the same principle and find for a cut-off value of 1.5 a sensitivity of 95% and a specificity of 100%. Conclusions: The CSI allows to evaluate newborns and infants for aortic coarctation with simple morphologic measurement that are not depending of the left ventricular function, presence of a patent ductus arteriosus or not. Further aggressive evaluation of these patient with a CSI _ 1.5 is indicated.

Neutral atoms in ionic lattices: Excited states of KCl:Ag(0)

The optical-absorption spectrum of a cationic Ag0 atom in a KCl crystal has been studied theoretically by means of a series of cluster models of increasing size. Excitation energies have been determined by means of a multiconfigurational self-consistent field procedure followed by a second-order perturbation correlation treatment. Moreover results obtained within the density-functional framework are also reported. The calculations confirm the assignment of bands I and IV to transitions of the Ag-5s electron into delocalized states with mainly K-4s,4p character. Bands II and III have been assigned to internal transitions on the Ag atom, which correspond to the atomic Ag-4d to Ag-5s transition. We also determine the lowest charge transfer (CT) excitation energy and confirm the assignment of band VI to such a transition. The study of the variation of the CT excitation energy with the Ag-Cl distance R gives additional support to a large displacement of the Cl ions due to the presence of the Ag0 impurity. Moreover, from the present results, it is predicted that on passing to NaCl:Ag0 the CT onset would be out of the optical range while the 5s-5p transition would undergo a redshift of 0.3 eV. These conclusions, which underline the different character of involved orbitals, are consistent with experimental findings. The existence of a CT transition in the optical range for an atom inside an ionic host is explained by a simple model, which also accounts for the differences with the more common 3d systems. The present study sheds also some light on the R dependence of the s2-sp transitions due to s2 ions like Tl+.

Juxtaposition of melt impregnation and high-temperature shear zones in the upper mantle; field and petrological constraints from the Lanzo peridotite (Northern Italy)

Results of a field and microstructural study between the northern and the central bodies of the Lanzo plagioclase peridotite massif (NW Italy) indicate that the spatial distribution of deformation is asymmetric across kilometre-scale mantle shear zones. The southwestern part of the shear zone (footwall) shows a gradually increasing degree of deformation from porphyroclastic peridotites to mylonite, whereas the northeastern part (hanging wall) quickly grades into weakly deformed peridotites. Discordant gabbroic and basaltic dykes are asymmetrically distributed and far more abundant in the footwall of the shear zone. The porphyroclastic peridotite displays porphyroclastic zones and domains of igneous crystallization whereas mylonites are characterized by elongated porphyroclasts, embedded between fine-grained, polycrystalline bands of olivine, plagioclase, clinopyroxene, orthopyroxene, spinel, rare titanian pargasite, and domains of recrystallized olivine. Two types of melt impregnation textures have been found: (1) clinopyroxene porphyroclasts incongruently reacted with migrating melt to form orthopyroxene plagioclase; (2) olivine porphyroclasts are partially replaced by interstitial orthopyroxene. The meltrock reaction textures tend to disappear in the mylonites, indicating that deformation in the mylonite continued under subsolidus conditions. The pyroxene chemistry is correlated with grain size. High-Al pyroxene cores indicate high temperatures (11001030C), whereas low-Al neoblasts display lower final equilibration temperatures (860C). The spinel Cr-number [molar Cr/(Cr Al)] and TiO2 concentrations show extreme variability covering almost the entire range known from abyssal peridotites. The spinel compositions of porphyroclastic peridotites from the central body are more variable than spinel from mylonite, mylonite with ultra-mylonite bands, and porphyroclastic rocks of the northern body. The spinel compositions probably indicate disequilibrium and would favour rapid cooling, and a faster exhumation of the central peridotite body, relative to the northern one. Our results indicate that melt migration and high-temperature deformation are juxtaposed both in time and space. Meltrock reaction may have caused grain-size reduction, which in turn led to localization of deformation. It is likely that melt-lubricated, actively deforming peridotites acted as melt focusing zones, with permeabilities higher than the surrounding, less deformed peridotites. Later, under subsolidus conditions, pinning in polycrystalline bands in the mylonites inhibited substantial grain growth and led to permanent weak zones in the upper mantle peridotite, with a permeability that is lower than in the weakly deformed peridotites. Such an inversion in permeability might explain why actively deforming, fine-grained peridotite mylonite acted as a permeability barrier and why ascending mafic melts might terminate and crystallize as gabbros along actively deforming shear zones. Melt-lubricated mantle shear zones provide a mechanism for explaining the discontinuous distribution of gabbros in oceancontinent transition zones, oceanic core complexes and ultraslow-spreading ridges.

Stable isotope geochemistry and phase-equilibria of coesite-bearing whiteschists, Dora Maira massif, Western Alps

Peak metamorphic temperatures for the coesite-pyrope-bearing whiteschists from the Dora Maira Massif, western Alps were determined with oxygen isotope thermometry. The deltaO-18(SMOW) values of the quartz (after coesite) (delta O-18 = 8.1 to 8.6 parts per thousand, n = 6), phengite (6.2 to 6.4 parts per thousand, n = 3), kyanite (6.1 parts per thousand, n = 2), garnet (5.5 to 5.8 parts per thousand, n = 9), ellenbergerite (6.3 parts per thousand, n = 1) and rutile (3.3. to 3.6 parts per thousand, n = 3) reflect isotopic equilibrium. Temperature estimates based on quartz-garnet-rutile fractionation are 700-750-degrees-C. Minimum pressures are 31-32 kb based on the pressure-sensitive reaction pyrope + coesite = kyanite + enstatite. In order to stabilize pyrope and coesite by the temperature-sensitive dehydration reaction talc + kyanite = pyrope + coesite + H2O, the a(H2O) must be reduced to 0.4-0.75 at 700 750-degrees-C. The reduced a(H2O) cannot be due to dilution by CO2, as pyrope is not stable at X (CO2) > 0.02 (T = 750-degrees-C; P = 30 kb). In the absence of a more exotic fluid diluent (e.g. CH4 or N2), a melt phase is required. Granite solidus temperatures are approximately 680-degrees-C/30 kb at a(H2O) = 1.0 and are calculated to be approximately 70-degrees-C higher at a(H2O) = 0.7, consistent with this hypothesis. Kyanite-jadeite-quartz bands may represent a relict melt phase. Peak P-T-f(H2O) estimates for the whiteschist are 34 +/- 2 kb, 700-750-degrees-C and 0.4-0.75. The oxygen isotope fractionation between quartz (deltaO-18 = 11.6%.) and garnet (deltaO-18 = 8.7 parts per thousand) in the surrounding orthognesiss is identical to that in the coesite-bearing unit, suggesting that the two units shared a common, final metamorphic history. Hydrogen isotope measurements were made on primary talc and phengite (deltaD(smow) = -27 to -32 parts per thousand), on secondary talc and chlorite after pyrope (deltaD = - 39 to - 44 parts per thousand) and on the surrounding biotite (deltaD = -64 parts per thousand) and phengite (deltaD = -44 parts per thousand) gneiss. All phases appear to be in near-equilibrium. The very high deltaD values for the primary hydrous phases is consistent with an initial oceanic-derived/connate fluid source. The fluid source for the retrograde talc + chlorite after pyrope may be fluids evolved locally during retrograde melt crystallization. The similar deltaD, but dissimilar deltaO-18 values of the coesite-bearing whiteschists and hosting orthogneiss suggest that the two were in hydrogen isotope equilibrium, but not oxygen isotope equilibrium. The unusual hydrogen and oxygen isotope compositions of the coesite-bearing unit can be explained as the result of metasomatism from slab-derived fluids at depth.

Sedimentation and electrophoretic migration of DNA knots and catenanes.

Various site-specific recombination enzymes produce different types of knots or catenanes while acting on circular DNA in vitro and in vivo. By analysing the types of knots or links produced, it is possible to reconstruct the order of events during the reaction and to deduce the molecular "architecture" of the complexes that different enzymes form with DNA. Until recently it was necessary to use laborious electron microscopy methods to identify the types of knots or catenanes that migrate in different bands on the agarose gels used to analyse the products of the reaction. We reported recently that electrophoretic migration of different knots and catenanes formed on the same size DNA molecules is simply related to the average crossing number of the ideal representations of the corresponding knots and catenanes. Here we explain this relation by demonstrating that the expected sedimentation coefficient of randomly fluctuating knotted or catenated DNA molecules in solution shows approximately linear correlation with the average crossing number of ideal configurations of the corresponding knots or catenanes.

Adaptation to Abundant Low Quality Food Improves the Ability to Compete for Limited Rich Food in Drosophila melanogaster.

The rate of food consumption is a major factor affecting success in scramble competition for a limited amount of easy-to-find food. Accordingly, several studies report positive genetic correlations between larval competitive ability and feeding rate in Drosophila; both become enhanced in populations evolving under larval crowding. Here, we report the experimental evolution of enhanced competitive ability in populations of D. melanogaster previously maintained for 84 generations at low density on an extremely poor larval food. In contrast to previous studies, greater competitive ability was not associated with the evolution of higher feeding rate; if anything, the correlation between the two traits across lines tended to be negative. Thus, enhanced competitive ability may be favored by nutritional stress even when competition is not intense, and competitive ability may be decoupled from the rate of food consumption.

Establishment of an in vitro system for studies on the induced resistance of cotton to Xanthomonas campestris pv. malvacearum

An in vitro system for studying the resistance response of cotton (Gossypium hirsutum L.) to Xanthomonas campestris pv. malvacearum was investigated. Cell suspension cultures, established from hypocotyl-derived callus of cotton cultivar 101-102B, were treated with bacterial extracellular polysaccharides (EPS) extracted from the incompatible race 18 of X. campestris pv. malvacearum. EPS at 600 mug/mL caused pronounced darkening of the suspension cultures, as indicative of cell death, 48 hours after incubation. Protein electrophoresis analysis of the time course of EPS-treated cells showed differential accumulation of several protein bands after 12-24 hours. The time course of protein accumulation and cell death was consistent with an elicitor-mediated hypersensitive response.

The Hercynian structure of the Catalonian Coastal Ranges (NE Spain)

In the Catalonian Coastal Ranges, Paleozoic sedimentary and meta-sedimentary rocks crop out in severa1 areas, intruded by late tectonic Hercynian granitoids and separated by Mesozoic and Tertiary cover sediments. Large structures are often difficult to recognize, although a general east-west trend can be observed on the geological map. Deformation was accompanied by the development of cleavages and regional metamorphism. Green-schist facies rocks are prominent throughout the Ranges, while amphibolite facies are restricted to small areas. In low-grade areas, the main deformation phase generated south-facing folds with an axial plane cleavage (slaty cleavage in metapelitic rocks). The intersection lineation (Ss/Sl) and the axes of minor folds trend cast-west, as do all mapable structures. Late deformations generated coarse crenulations, small chevrons and kink-bands, all intersecting the slaty cleavage at high angles. In medium- to high-grade areas no major folds have been observed. In these areas, the main foliation is a schistosity and is often folded, giving centimetric to decimetric, nearly isoclinal intrafolial folds. In schists, these folds aremuchmore common than inother lithologies, and can be associated with a crenulation cleavage. All these planar structures in high-grade rocks are roughly parallel. The late Hercynian deformational events, which gave rise to the crenulations and small chevrons, also produced large (often kilometric) open folds which fold the slaty cleavage and schistosity. As aconsequence, alternating belts with opposite dip (north and south) of the main foliation were formed. With respect to the Hercynian orogenic belt, the Paleozoic outcrops of the Catalonian Coastal Ranges are located within the northern branch of the Ibero-Armorican arc, and have a relatively frontal position within the belt. The Carboniferous of the Priorat-Prades area, together with other outcrops in the Castellón Province, the Montalbán massif (Iberian Chain) and the Cantabrian zone (specially the Pisuerga-Carrión Province) probably form part of a wide area of foreland Carboniferous deposition placed at the core of the arc.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Hordein polypeptide patterns in relation to malting quality in Brazilian barley varieties

Since there is evidence that malting quality is related to the storage protein (hordein) fraction, in the present work the hordein polypeptide patterns from 13 barley (Hordeum vulgare L.) varieties of different malting quality were analysed in order to explore the feasibility of using hordein electrophoresis to assist in the selection of malting barleys. The formation of clusters separating the varieties with higher malting quality from the others with lower quality suggests that there is a relationship between the general hordein polypeptide pattern and malting quality in the varieties analysed. By the Sperman's correlation test three hordein bands correlated negatively with malting quality in the germplasm studied.

Stimulus statistics shape oscillations in nonlinear recurrent neural networks.

Rhythmic activity plays a central role in neural computations and brain functions ranging from homeostasis to attention, as well as in neurological and neuropsychiatric disorders. Despite this pervasiveness, little is known about the mechanisms whereby the frequency and power of oscillatory activity are modulated, and how they reflect the inputs received by neurons. Numerous studies have reported input-dependent fluctuations in peak frequency and power (as well as couplings across these features). However, it remains unresolved what mediates these spectral shifts among neural populations. Extending previous findings regarding stochastic nonlinear systems and experimental observations, we provide analytical insights regarding oscillatory responses of neural populations to stimulation from either endogenous or exogenous origins. Using a deceptively simple yet sparse and randomly connected network of neurons, we show how spiking inputs can reliably modulate the peak frequency and power expressed by synchronous neural populations without any changes in circuitry. Our results reveal that a generic, non-nonlinear and input-induced mechanism can robustly mediate these spectral fluctuations, and thus provide a framework in which inputs to the neurons bidirectionally regulate both the frequency and power expressed by synchronous populations. Theoretical and computational analysis of the ensuing spectral fluctuations was found to reflect the underlying dynamics of the input stimuli driving the neurons. Our results provide insights regarding a generic mechanism supporting spectral transitions observed across cortical networks and spanning multiple frequency bands.

Identification of haptoglobin as an angiogenic factor in sera from patients with systemic vasculitis.

Angiogenesis is an important process in chronic inflammatory diseases. We observed that sera from patients with systemic vasculitis stimulated angiogenesis in an in vitro model using human umbilical vein endothelial cells cultured on a basement membrane (Matrigel) substrate. After 40% ammonium sulfate precipitation, angiogenic activity remained in the low molecular weight fraction and could be inactivated by heat. SDS-page of serum FPLC fractions exhibiting maximal angiogenic activity demonstrated two prominent species of 45 and 16-20 kD in patients' sera. These bands were much less apparent in sera obtained from control subjects. Amino-terminal sequencing of the 45-kD protein demonstrated that it was haptoglobin. Purified haptoglobin stimulated angiogenesis in a dose-dependent manner. The angiogenic activity of vasculitis patients' sera was partially inhibited by an antihaptoglobin antibody. Furthermore, serum haptoglobin levels in vasculitis patients correlated both with disease and angiogenic activity. Haptoglobin angiogenic activity was confirmed in two in vivo models using an implanted disc and a subcutaneous injection of basement membrane. Stimulation of angiogenesis is a newly recognized biological function of haptoglobin. The increased levels of haptoglobin found in chronic inflammatory conditions may play an important role in tissue repair. In systemic vasculitis, haptoglobin might also compensate for ischemia by promoting development of collateral vessels.

Characterization and discrimination of soils by their reflected electromagnetic energy

The objective of this work was to verify if reflected energy of soils can characterize and discriminate them. A spectroradiometer (Spectral reflectance between: 400-2,500 nm) was utilized in laboratory. The soils evaluated are located in Bauru region, SP, Brazil, and are classified as Typic Argiudoll (TR), Typic Eutrorthox (LR), Typic Argiudoll (PE), Typic Haplortox (LE), Typic Paleudalf (PV) and Typic Quartzipsamment (AQ). They were characterized by their spectral reflectance as for descriptive conventional methods (Brazilian and International) according to the types of spectral curves. A method for the spectral descriptive evaluation of soils was established. It was possible to characterize and discriminate the soils by their spectral reflectance, with exception for LR and TR. The spectral differences were better identified by the general shape of spectral curves, by the intensity of band absorption and angle tendencies. These characteristics were mainly influenced by organic matter, iron, granulometry and mineralogy constituents. A reduction of iron and clay contents, which influenced higher reflectance intensity and shape variations, occurred on the soils LR/TR, PE, LE, PV and AQ, on that sequence. Soils of the same group with different clay textures could be discriminated. The conventional descriptive evaluation of spectral curves was less efficient on discriminating soils. Simulated orbital data discriminated soils mainly by bands 5 and 7.

Effect of two dosages of Metarhizium anisopliae var. acridum against Rhammatocerus schistocercoides Rehn

The fungus Metarhizium anisopliae var. acridum, strain CG 423, was tested under field conditions against the gregarious grasshopper Rhammatocerus schistocercoides (Rehn) (Orthoptera: Acrididae). Conidia formulated in a racemic mixture of soybean oil and kerosene were sprayed under field conditions using an ultralow-volume hand-held atomizer Ulva Plus adjusted to deliver 2.9 L/ha. Bands composed of 2nd instar nymphs were treated with either 5.0x10(12) or 1.0x10(13) viable conidia/ha. The number of insects in each band was estimated at day one following spraying and by the end of the field trial (15 to 16 days post-treatment). Reductions in population size reached, in average, 65.8% and 80.4% for bands treated with the higher and lower dosage, respectively. For both dosages, total mortality rates of insects collected at two days post-application, and kept in cages for 14 days under lab conditions, showed no significant differences as compared to that obtained with insects collected immediately after spraying. Healthy insects were fed to native grasses sprayed on the field with 1.0x10(13) viable conidia/ha. Mortality levels of the nymphs fed on grasses collected two and four days post-application were not affected when compared to nymphs fed on grasses collected immediately following application.