804 resultados para ion diffraction


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Once unit-cell dimensions have been determined from a powder diffraction data set and therefore the crystal system is known (e.g. orthorhombic), the method presented by Markvardsen, David, Johnson & Shankland [Acta Cryst. (2001), A57, 47-54] can be used to generate a table ranking the extinction symbols of the given crystal system according to probability. Markvardsen et al. tested a computer program (ExtSym) implementing the method against Pawley refinement outputs generated using the TF12LS program [David, Ibberson & Matthewman (1992). Report RAL-92-032. Rutherford Appleton Laboratory, Chilton, Didcot, Oxon, UK]. Here, it is shown that ExtSym can be used successfully with many well known powder diffraction analysis packages, namely DASH [David, Shankland, van de Streek, Pidcock, Motherwell & Cole (2006). J. Appl. Cryst. 39, 910-915], FullProf [Rodriguez-Carvajal (1993). Physica B, 192, 55-69], GSAS [Larson & Von Dreele (1994). Report LAUR 86-748. Los Alamos National Laboratory, New Mexico, USA], PRODD [Wright (2004). Z. Kristallogr. 219, 1-11] and TOPAS [Coelho (2003). Bruker AXS GmbH, Karlsruhe, Germany]. In addition, a precise description of the optimal input for ExtSym is given to enable other software packages to interface with ExtSym and to allow the improvement/modification of existing interfacing scripts. ExtSym takes as input the powder data in the form of integrated intensities and error estimates for these intensities. The output returned by ExtSym is demonstrated to be strongly dependent on the accuracy of these error estimates and the reason for this is explained. ExtSym is tested against a wide range of data sets, confirming the algorithm to be very successful at ranking the published extinction symbol as the most likely. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We previously reported sequence determination of neutral oligosaccharides by negative ion electrospray tandem mass spectrometry on a quadrupole-orthogonal time-of-flight instrument with high sensitivity and without the need of derivatization. In the present report, we extend our strategies to sialylated oligosaccharides for analysis of chain and blood group types together with branching patterns. A main feature in the negative ion mass spectrometry approach is the unique double glycosidic cleavage induced by 3-glycosidic substitution, producing characteristic D-type fragments which can be used to distinguish the type 1 and type 2 chains, the blood group related Lewis determinants, 3,6-disubstituted core branching patterns, and to assign the structural details of each of the branches. Twenty mono- and disialylated linear and branched oligosaccharides were used for the investigation, and the sensitivity achieved is in the femtomole range. To demonstrate the efficacy of the strategy, we have determined a novel complex disialylated and monofucosylated tridecasaccharide that is based on the lacto-N-decaose core. The structure and sequence assignment was corroborated by :methylation analysis and H-1 NMR spectroscopy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The low-energy electron diffraction (LEED) pattern of the step-kinked Pt{531} surface at 200 K shows energy-dependent cancellation of diffraction spots over unusually large energy ranges, up to 100 eV. This cannot be reproduced theoretically when a flat surface geometry is assumed. A relatively simple model of roughening, however, involving 0.25 ML of vacancies and adatoms leads to very good agreement with the experiment. The cancellation of intensities within a very narrow range of adatom or vacancy coverages is caused by the interference of electrons emerging from different heights but similar local environments. This is a rare example where the energy dependence of integrated LEED spot intensities is dramatically affected by the long-range arrangement of atoms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a FORTRAN-90 program to compute low-energy electron diffraction I(V) curves. Plane-waves and layer doubling are used to compute the inter-layer multiple-scattering, while the intra-layer multiple-scattering is computed in the standard way expanding the wavefield on a basis of spherical waves. The program is kept as general as possible, in order to allow testing different parts of multiple-scattering calculations. In particular, it can handle non-diagonal t-matrices describing the scattering of non-spherical potentials, anisotropic vibrations, anharmonicity, etc. The program does not use old FORTRAN flavours, and has been written keeping in mind the advantage for parallelism brought forward by FORTRAN-90.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coatings and filters for spaceflight far-infrared components require a robust, non-absorptive low-index thin film material to contrast with the typically higher refractive index infrared materials. Barium fluoride is one such material for the 10 to 20µm wavelength infrared region, however its optical and mechanical properties vary depending on the process used to deposit it in thin film form. Thin films of dielectric produced by thermal evaporation are well documented as having a lower packing density and refractive index than bulk material. The porous and columnar micro structure of these films causes possible deterioration of their performance in varied environmental conditions, primarily because of the moisture absorption. Dielectric thin films produced by the more novel technique of ion-beam sputtering are denser with no columnar micro structure and have a packing density and refractive index similar to the bulk material. A comparative study of Barium Fluoride (BaF2) thin films made by conventional thermal evaporation and ion-beam sputtering is reported. Films of similar thicknesses are deposited on Cadmium Telluride and Germanium substrates. The optical and mechanical properties of these films are then examined. The refractive index n of the films is obtained from applying the modified Manifacier's evvelope method to the spectral measurements made on a Perkin Elmer 580 spectrophotometer. An estimate is also made of the value of the extinction coefficient k in the infrared wavelength transparent region of the thin film. In order to study the mechanical properties of the BaF2 films, and evaluate their usefulness in spaceflight infrared filters and coatings, the thin film samples are subjected to MIL-F-48616 environmental tests. Comparisons are made of their performance under these tests.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Two complex heterometallic salts with formulae Tl-6[Fe(CN)(6)](1) (33)(NO3)(OH) (1) and [Co(bpy)(2)(CN)(2)](2){[Ag(CN)(2)](0) (5)[Fe(CN)(6)](0) (5)} 8H(2)O (2) have been synthesized and fully characterized Single crystal X-ray analyses reveal that compound 1 is comprised of discrete Tl+ cations and [Fe(CN)(6)](3-) anions together with OH- and NO3- anions Compound 2 contains [Co(bpy)(2)(CN)(2)](+) cations and {[Ag(CN)(2)][Fe(CN)(6)]}(-) anions together with eight molecules of water of crystallization Both structures form unprecedented three-dimensional supramolecular networks via non covalent interactions Another important observation is that the stereochemically active inert (lone) pair present on Tl+ plays little role in controlling the structure of 1 The water molecules in 2 play important roles in providing stability organizing a supramolecular network through hydrogen bonding In the syntheses of 1 and 2 Fe(II) is oxidized to Fe(III) and Co(II) to Co(III) respectively facilitating the formation of the salts that are obtained Both compounds exhibit photoluminescence emission in solution near the visible region.