Phenotypic and genotypic analysis of mouse hepatitis virus (JHM) complementation group A temperature-sensitive mutants

Temperature sensitive (ts) mutant viruses have helped elucidate replication processes in many viral systems. Several panels of replication-defective ts mutants in which viral RNA synthesis is abolished at the nonpermissive temperature (RNA$\sp{-})$ have been isolated for Mouse Hepatitis Virus, MHV (Robb et al., 1979; Koolen et al., 1983; Martin et al., 1988; Schaad et al., 1990). However, no one had investigated genetic or phenotypic relationships between these different mutant panels. In order to determine how the panel of MHV-JHM RNA$\sp{-}$ ts mutants (Robb et al., 1979) were genetically related to other described MHV RNA$\sp{-}$ ts mutants, the MHV-JHM mutants were tested for complementation with representatives from two different sets of MHV-A59 ts mutants (Koolen et al., 1983; Schaad et al., 1990). The three ts mutant panels together were found to comprise eight genetically distinct complementation groups. Of these eight complementation groups, three complementation classes are unique to their particular mutant panel; genetically equivalent mutants were not observed within the other two mutant panels. Two complementation groups were common to all three mutant panels. The three remaining complementation groups overlapped two of the three mutant sets. Mutants MHV-JHM tsA204 and MHV-A59 ts261 were shown to be within one of these overlapping complementation groups. The phenotype of the MHV-JHM mutants within this complementation class has been previously characterized (Leibowitz et al., 1982; Leibowitz et al, 1990). When these mutants were grown at the permissive temperature, then shifted up to the nonpermissive temperature at the start of RNA synthesis, genome-length RNA and leader RNA fragments accumulated, but no subgenomic mRNA was synthesized. MHV-A59 ts261 produced leader RNA fragments identical to those observed with MHV-JHM tsA204. Thus, these two MHV RNA$\sp{-}$ ts mutants that were genetically equivalent by complementation testing were phenotypically similar as well. Recombination frequencies obtained from crosses of MHV-A59 ts261 with several of the gene 1 MHV-A59 mutants indicated that the causal mutation(s) of MHV-A59 ts261 was located near the overlapping junction of ORF1a and ORF1b, in the 3$\sp\prime$ end of ORF1a, or the 5$\sp\prime$ end of ORF1b. Sequence analysis of this junction and 1400 nucleotides into the 5$\sp\prime$ end of ORF1b of MHV-A59 ts261 revealed one nucleotide change from the wildtype MHV-A59. This substitution at nucleotide 13,598 (A to G) was a silent mutation in the ORF1a reading frame, but resulted in an amino acid change in ORF1b gene product (I to V). This amino acid change would be expressed only in the readthrough translation product produced upon successful ribosome frameshifting. A revertant of MHV-A59 ts261 (R2) also retained this guanidine residue, but had a second substitution at nucleotide 14,475 in ORF1b. This mutation results in the substitution of valine for an isoleucine.^ The data presented here suggest that the mutation in MHV-A59 ts261 (nucleotide 13,598) would be responsible for the MHV-JHM complementation group A phenotype. A second-site reversion at nucleotide 14,475 may correct this defect in the revertant. Sequencing of gene 1 immediately upstream of nucleotide 13,296 and downstream of nucleotide 15,010 must be conducted to test this hypothesis. ^

Genetic Relatedness, Antimicrobial and Biocide Susceptibility Comparative Analysis of Methicillin-Resistant and -Susceptible Staphylococcus pseudintermedius from Portugal

Forty methicillin-resistant and -susceptible Staphylococcus pseudintermedius (MRSP and MSSP, respectively) from colonization and infection in dogs and cats were characterized for clonality, antimicrobial, and biocide susceptibility. MSSP were genetically more diverse than MRSP by multi-locus sequence typing and pulsed-field gel electrophoresis. Three different spa types (t06, t02, t05) and two SCCmec types (II-III and V) were detected in the MRSP isolates. All MRSP and two MSSP strains were multidrug-resistant. Several antibiotic resistance genes (mecA, blaZ, tet(M), tet(K), aac(6')-Ie-aph(2')-Ia, aph(3')-III, ant(6)-Ia, sat4, erm(B), lnu(A), dfr(G), and catpC221) were identified by microarray and double mutations in the gyrA and grlA genes and a single mutation in the rpoB gene were detected by sequence analysis. No differences were detected between MSSP and MRSP in the chlorhexidine acetate (CHA) minimum inhibitory concentrations (MICs). However, two MSSP had elevated MIC to triclosan (TCL) and one to benzalkonium chloride and ethidium bromide. One MSSP isolate harboured a qacA gene, while in another a qacB gene was detected. None of the isolates harboured the sh-fabI gene. Three of the biocide products studied had high bactericidal activity (Otodine(®), Clorexyderm Spot Gel(®), Dermocanis Piocure-M(®)), while Skingel(®) failed to achieve a five log reduction in the bacterial counting. S. pseudintermedius have become a serious therapeutic challenge in particular if methicillin- resistance and/or multidrug-resistance are involved. Biocides, like CHA and TCL, seem to be clinically effective and safe topical therapeutic options.

Heat Shock Protein 90 (HSP90) and Her2 in Adenocarcinomas of the Esophagus.

Her2 overexpression and amplification can be found in a significant subset of esophageal adenocarcinomas. The activity of Her2 has been shown to be modulated by molecular chaperones such as HSP90. We analyzed expression/amplification data for HSP90 and Her2 on 127 primary resected esophageal adenocarcinomas in order to evaluate a possible relationship between these two molecules. HSP90 expression determined by immunohistochemistry was observed in various levels. Thirty nine (39) tumors (30.7%) were classified as Her2-positive according to their immunoreactivity and amplification status. There was a significant correlation between HSP90 expression and Her2-status (p = 0.008). This could also be demonstrated by quantitative protein expression analysis with reverse phase protein arrays (r = 0.9; p < 0.001). Her2-status was associated withpT-category (p = 0.041), lymph node metastases (p = 0.049) and tumor differentiation (p = 0.036) with a higher percentage of cases with negative Her2 status in lower tumor stagesA negative Her2-status was also associated with better survival in univariate and multivariate analysis (p = 0.001 and p = 0.014). For HSP90, no associations between clinical and pathological parameters were found. The observed association between HSP90 expression and Her2 suggests a co-regulation of these molecules in at least a subset of esophageal adenocarcinomas. Anti-HSP90 drugs, which recently have been introduced in cancer treatment, may also be an option for these tumors by targeting HSP90 alone or in combination with Her2.

Play in Rats: Association across Contexts and Types , and Analysis of Structure.

Play has been proposed as a promising indicator of positive animal welfare. We aimed to study play in rats across contexts (conspecific/heterospecific) and types (social: pinning, being pinned; solitary: scampering), and we investigated its structure using behavioral sequence analysis. Group-housed (three per cage) adolescent male Lister Hooded rats (n = 21) were subjected to a Play-In-Pairs test: after a 3 hour isolation period, a pair of cage-mates was returned to the home cage and both social and solitary play were scored for 20 min. This procedure was repeated for each pair combination across three consecutive days, and individual play scores were calculated. Heterospecific play was measured using a Tickling test: rats were individually tickled by the experimenter through bouts of gentle, rapid finger movements on their underside, and the number of positive 50 kHz frequency modulated vocalizations and experimenter-directed approach behaviors were recorded. Both of the above tests were compared with social play in the home cage. While conspecific play in both the Play-In-Pairs test and home cage were correlated, both seemed to be unrelated to heterospecific play in the Tickling test. During the Play-In-Pairs test, although both solitary and social play types occurred, they were unrelated, and solitary locomotor play of one rat did not predict the subsequent play behavior of its cage mate. Analysis of play structure revealed that social play occurred more often in bouts of repeated behaviors while solitary play sequences did not follow a specific pattern. If play is to be used as an indicator of positive welfare in rats, context, type and structure differences should be taken into account.

Detection of one VH antibody sequence in both healthy donors and urticaria patients.

We have previously isolated anti-FcepsilonRIalpha autoantibodies from phage libraries of healthy donors and urticaria patients. Strikingly, the same antibody, LTMalpha15, was isolated from both libraries. Sequence analysis revealed a germline configuration of the LTMalpha15 variable heavy (V(H)) chain with a slightly mutated variable light (V(L)) chain supporting its classification as a natural autoantibody. Distribution analysis of anti-FcepsilonRIalpha autoantibodies by functional or serological tests delivered conflicting data. For this reason we have developed a new real-time PCR to analyse the distribution of LTMalpha15V(H) in healthy donors and urticaria patients. Our new bioinformatic program permitted the design of a minor groove binder (MGB) TaqMan probe that specifically detected the LTMalpha15V(H). We were able to demonstrate a broad range of rearranged V(H) gene copy number without any correlation to the state of health. Monitoring LTMalpha15V(H) gene copy number in a single donor over a period of 70 days revealed a time-related fluctuation of circulating B cells carrying LTMalpha15V(H). We propose that our real-time PCR may serve as a model for the quantification of natural antibody sequences at a monoclonal level.

Simultaneous analysis of nuclear and mitochondrial DNA, mRNA and miRNA from backspatter from inside parts of firearms generated by shots at "triple contrast" doped ballistic models

When a firearm projectile hits a biological target a spray of biological material (e.g., blood and tissue fragments) can be propelled from the entrance wound back towards the firearm. This phenomenon has become known as "backspatter" and if caused by contact shots or shots from short distances traces of backspatter may reach, consolidate on, and be recovered from, the inside surfaces of the firearm. Thus, a comprehensive investigation of firearm-related crimes must not only comprise of wound ballistic assessment but also backspatter analysis, and may even take into account potential correlations between these emergences. The aim of the present study was to evaluate and expand the applicability of the "triple contrast" method by probing its compatibility with forensic analysis of nuclear and mitochondrial DNA and the simultaneous investigation of co-extracted mRNA and miRNA from backspatter collected from internal components of different types of firearms after experimental shootings. We demonstrate that "triple contrast" stained biological samples collected from the inside surfaces of firearms are amenable to forensic co-analysis of DNA and RNA and permit sequence analysis of the entire mtDNA displacement-loop, even for "low template" DNA amounts that preclude standard short tandem repeat DNA analysis. Our findings underscore the "triple contrast" method's usefulness as a research tool in experimental forensic ballistics.

Identification and characterization of virulence factors in Enterococcus faecalis

Enterococci are one of the leading causes of nosocomial infections, and Enterococcus faecalis causes the majority of enterococcal infections. However, the mechanisms of enterococcal pathogenesis are still not yet understood. In our initial screening of E. faecalis strain OG1RF genomic libraries, autolysin and a homolog of a protein of Enterococcus faecium previously designated P54 were found to be two major antigens that reacted with human patient sera, and an antigen designated MH-1 antigen that reacted with serum from a endocarditis patient was also identified. To explore a possible role for these antigens in enterococcal infections, the genes encoding these three antigens were disrupted in Enterococcus faecalis OG1RF. ^ To explore a possible role of an E. faecalis gelatinase (encoded by gelE), which belongs to a family of Zn-metalloproteases that have been shown to be virulence factors in other organisms, in enterococcal infections, an insertion mutant was constructed in OG1RF and tested in the mouse peritonitis model. The mice infected with the gelE mutant showed a significantly prolonged survival compared to the wild type strain. To study the expression of gelE, the regions flanking gelE were sequenced. Sequence analysis of the gelE flanking regions revealed three genes (fsrA, fsrB and fsrC) upstream of gelE that show homology to the genes in a locus (agr) that globally regulates the expression of virulence factors in Staphylococcus aureus and one open reading frame (sprE) with homology to bacterial serine protease downstream of gelE. ^ In conclusion, in this study of identification of possible virulence factors in E. faecalis surface and secreted proteins, of three genes encoding antigens detected by human patient sera, none could be shown to effect virulence in the mouse peritonitis model. Inactivation of one of these antigens (autolysin) was shown to slightly increase the tolerance of E. faecalis to penicillin. A serine protease and a locus (fsr) that regulates the expression of gelE and sprE were shown to be important for enterococcal infection in the mouse peritonitis model. (Abstract shortened by UMI.)^

Characterization of hLodestar: A CDC5L interacting protein

Lodestar, a Drosophila maternal-effect gene, is essential for proper chromosome segregation during embryonic mitosis. Mutations in lodestar cause chromatin bridging in anaphase, preventing the sister chromatids from fully separating and leaving chromatin tangled at the metaphase plate. Drosophila lodestar protein was originally identified, in purified fractions of Drosophila Kc cell nuclear extracts, by its ability to suppress the generation of long RNA polymerase II transcripts. The human homolog of this protein (hLodestar) was cloned and studied in comparison to the Drosophila lodestar activities. The results of these studies show, similar to the Drosophila protein, hLodestar has dsDNA-dependent ATPase and transcription termination activity in vitro. hLodestar has also been shown to release RNA polymerase I and II stalled at a cyclobutane thymine dimer. Lodestar belongs to the SNF2 family of proteins, which are members of the DExH/D helicase super-family. The SNF2 family of proteins are believed to play a critical role in altering protein-DNA interactions in a variety of cellular contexts. We have recently isolated a human cDNA (hLodestar) that shares significant homology to the Drosophila lodestar gene. The 4.6 kb clone contains an open reading frame of 1162 amino acids, and shares 55% similarity and 46% identity to the Drosophila Lodestar protein sequence. Our studies looking for hLodestar interacting proteins revealed an association with CDC5L in the yeast two-hybrid system and co-immunoprecipitation experiments. CDC5L has been well documented to be a component of the spliceosome. Our data suggests hLodestar is involved in splicing through in vitro assembly and splicing reactions, in addition to its association with spliceosomes purified from HeLa nuclear extract. Although many other members of the DExH/D helicase super-family have been linked to splicing, this is the first SNF2 family member to be implicated in the splicing reaction. ^

REGULATION OF FOXC2 EXPRESSION AND FUNCTION DURING EPITHELIAL-MESENCHYMAL TRANSITION BY GSK-3β

Metastasis is the ultimate cause for the majority of cancer-related deaths. The forkhead box transcription factor FOXC2 is known to be involved in regulating metastasis as well as a variety of developmental processes, including the formation of lymphatic and cardiovascular systems. Previous studies have shown that FOXC2 protein is localized either in the nucleus and/or in the cytoplasm of human breast tumor cells. This pattern of localization is similar to that of another forkhead family member, FOXO3a. Additionally, localization of FOXO3a is known to be differentially regulated by upstream kinase AKT. Therefore, I investigated whether FOXC2 localization could also be regulated by upstream kinases. Analysis of FOXC2 protein sequence revealed two potential phosphorylation sites for GSK-3β. Furthermore, inhibition of GSK-3βsignificantly reduces FOXC2 protein. In addition, exposure of HMLE Twist cells expressing endogenous FOXC2 to the GSK-3β inhibitor, TWS119, results in accumulation of FOXC2 protein in the cytoplasm with concomitant decrease in the nucleus in a time-dependent manner. Furthermore, continued treatment with TWS119 eventually induces epithelial morphology and decreased stem cell properties including sphere formation in these cells. Further characterization of FOXC2- GSK-3β interaction and the associated signaling cascade are necessary to determine the effect of FOXC2 phosphorylation by GSK-3β on EMT and metastasis.

Structure and biosynthesis of a pyruvate -dependent enzyme---phosphatidylserine decarboxylase from {\it Escherichia coli\/}

Phosphatidylserine decarboxylase of E. coli, a cytoplasmic membrane protein, catalyzes the formation of phosphatidylethanolamine, the principal phospholipid of the organism. The activity of the enzyme is dependent on a covalently bound pyruvate (Satre and Kennedy (1978) J. Biol. Chem. 253, 479-483). This study shows that the enzyme consists of two nonidentical subunits, $\alpha$ (Mr = 7,332) and $\beta$ (Mr = 28,579), with the pyruvate prosthetic group in amide linkage to the amino-terminus of the $\alpha$ subunit. Partial protein sequence and DNA sequence analysis reveal that the two subunits are derived from a proenzyme ($\pi$ subunit, Mr = 35,893) through a post-translational event. During the conversion of the proenzyme to the $\alpha$ and $\beta$ subunits, the peptide bond between Gly253-Ser254 is cleaved, and Ser254 is converted to the pyruvate prosthetic group at the amino-terminus of the $\alpha$ subunit (Li and Dowhan (1988) J. Biol. Chem. 263, 11516-11522).^ The proenzyme cannot be detected in cells carrying either single or multiple copies of the gene (psd), but can be observed in a T7 RNA polymerase/promoter and transcription-translation system. The cleavage of the wild-type proenzyme occurs rapidly with a half-time on the order of 2 min. Changing of the Ser254 to cysteine (S254C) or threonine (S254T) slows the cleavage rate dramatically and results in mutants with a half-time for processing of around 2-4 h. Change of the Ser254 to alanine (S254A) blocks the cleavage of the proenzyme. The reduced processing rate with the mutations of the proenzyme is consistent with less of the functional enzyme being made. Mutants S254C and S254T produce $\sim$15% and $\sim$1%, respectively, of the activity of the wild-type allele, but can still complement a temperature-sensitive mutant of the psd locus. Neither detectable activity nor complementation is observed by mutant S254A. These results are consistent with the hydroxyl-group of the Ser254 playing a critical role in the cleavage of the peptide bond Gly253-Ser254 of the pro-phosphatidylserine decarboxylase, and support the mechanism proposed by Snell and co-workers (Recsei and Snell (1984) Annu. Rev. Biochem. 53, 357-387) for the formation of the prosthetic group of pyruvate-dependent decarboxylases. ^

The transcriptional regulation of the {\it neu\/} gene: Examples of activation, repression, and cell-specific expression

The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^

Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Role and regulation of c-KIT gene expression in tumor growth and metastasis of human melanoma

The purpose of this study was to investigate the role of the c-KIT receptor in the progression of human melanoma and the mechanism(s) for the regulation of c-KIT gene expression in human melanoma.^ The molecular changes associated with the transition of melanoma cells from radial growth phase (RGP) to vertical growth phase (VGP) (metastatic phenotype) are not well-defined. Expression of the tyrosine-kinase receptor c-KIT progressively decreases during local tumor growth and invasion of human melanomas. To provide direct evidence that the metastasis of human melanoma is associated with the loss of c-KIT expression, highly metastatic A375SM cells, which express very low or undetectable levels of c-KIT, were tranduced with the human c-KIT gene. We demonstrated that enforced c-KIT expression in highly metastatic human melanoma cells significantly suppressed their tumorigenicity and metastatic propensity in nude mice. In addition, we showed that the ligand for c-KIT, SCF, induces apoptosis in human melanoma cells expressing c-KIT under both in vitro and in vivo conditions. These results suggest that loss of c-KIT receptor may allow malignant melanoma cells to escape SCF/c-KIT-mediated apoptosis, thus contributing to tumor growth and eventually metastasis.^ Furthermore, we investigated the possible mechanism(s) for the down-regulation of c-KIT gene expression in malignant melanoma. Sequence analysis of the c-KIT promoter indicated that this promoter contains several consensus binding-site sequences including three putative AP2 and two Myb sites. Although Myb was shown to be associated with c-KIT expression in human hemotopoietic cells, we found no correlation between c-KIT expression and Myb expression in human melanoma cell lines. In contrast, we showed that c-KIT expression directly correlates with expression of AP2 in human melanoma cells. We found that highly metastatic cells do not express the transcription factor AP2. Expression of AP2 in A375SM cells (c-KIT-negative and AP2-negative) was enough to restore luciferase activity driven by the c-KIT promoter in a dose-dependent manner. On the other hand, co-expression of the dominant-negative form of AP2 (AP2B) in Mel-501 cells (c-KIT-positive and AP2-positive) resulted in two-fold reduction in luciferase activity. Electrophoretic mobility shift assays revealed that the c-KIT promoter contains functional AP2 binding sites which could associate with AP2 protein. Endogenous c-KIT gene expression levels were elevated in AP2 stably-transfected human melanoma A375SM cells. Expression of exogenous AP2 in A375SM cells inhibited their tumorigenicity and metastatic potential in nude mice. The c-KIT ligand, SCF, also induced apoptosis in the AP2 stably-transfected A375SM cells. The identification of AP2 as an important regulator for c-KIT expression suggests that AP2 may have tumor growth and metastasis inhibitory properties, possibly mediated through c-KIT/SCF effects on apoptosis of human melanoma cells. Since AP2 binding sites were found in the promoters of other genes involved in the progression of human melanoma, such as MMP2 (72 kDa collagenase), MCAM/MUC18 and P21/WAF-1, our findings suggest that loss of AP2 expression might be a crucial event in the development of malignant melanoma. ^

ATXA -dependent gene expression in Bacillus anthracis

The Bacillus anthracis toxin genes, cya, lef , and pag, can be viewed as a regulon, in which transcription of all three genes is activated in trans by the same regulatory gene, atxA, in response to the same signal, CO2. I determined that several phenotypes are associated with the atxA gene. In addition to being toxin-deficient, an atxA -null mutant grows poorly on minimal media and sporulates early compared to the parent strain. Furthermore, an atxA-null mutant has an altered 2-D gel protein profile. I used a genetic approach to find additional atxA-regulated genes. Random transcriptional lacZ fusions were generated in B. anthracis using transposon Tn 917-LTV3. Transposon-insertion libraries were screened for mutants expressing increased β-galactosidase activity in 5% CO2. Introduction of an atxA-null mutation in these mutants revealed that 79% of the CO2-regulated fusions were also atxA-dependent. DNA sequence analysis of transposon insertion sites in mutants carrying CO 2/atxA-regulated fusions revealed ten mutants harboring transposon insertions in loci distinct from the toxin genes. The majority of the tcr (toxin co-regulated) loci mapped within the pXO1 pathogenicity island. These results indicate a clear association of atxA with CO2-enhanced gene expression in B. anthracis and provide evidence that atxA regulates genes other than the structural genes for the anthrax toxin proteins. ^ Characterization of one tcr locus revealed a new regulatory gene, pagR. The pagR gene (300 nt) is located downstream of pag. pagR is cotranscribed with pag and is responsible for autogenous control of the operon. pagR also represses expression of cya and lef. Repression of toxin gene expression by pagR may be mediated by atxA. The steady state level of atxA mRNA is increased in a pagR mutant. Recombinant PagR protein purified from Escherichia coli did not specifically bind the promoter regions of pagA or atxA. An unidentified factor in B. anthracis crude extracts, however, was able to bind the atxA promoter in the absence of PagR or AtxA. These investigations increase our knowledge of virulence regulation in B. anthracis and ultimately will lead to a better understanding of anthrax disease. ^