1000 resultados para MIOPÍA – PROGRESIÓN - NIÑOS 10 -14 AÑOS


Relevância:

100.00% 100.00%

Publicador:

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1913/10/14 (N13324,A36).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1918/10/14 (N15057,A42).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1909/10/14 (N3154,A26).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1907/10/14 (N11131,A30).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1891/10/14 (N5289,A15).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Epidemiological and clinical evidence suggests that a judicious diet, regular physical activity and blood pressure (BP) monitoring must start in early childhood to minimize the impact of modifiable cardiovascular risk factors. This study was designed to evaluate BP and metabolic parameters of schoolchildren from Vitória, Espírito Santo State, Brazil, and correlate them with cardiovascular risk factors. The study was conducted on 380 students aged 10-14 years (177 boys, 203 girls) enrolled in public schools. Baseline measurements included body mass index, BP and heart rate. The students were submitted to exercise spirometry on a treadmill. VO2max was obtained from exercise testing to voluntary exhaustion. Fasting serum total cholesterol (TC), LDL-C, HDL-C, triglycerides (TG), and glucose were measured. Nine point nine percent of the boys and 11.7% of the girls were hypertensive or had pre-hypertensive levels. There was no significant correlation between VO2max and TC, LDL-C, or TG in prepubertal children, but a slight negative correlation was detected in post-pubertal boys for HDL-C and TG. In addition, children with hypertension (3.4%) or pre-hypertensive levels (6.6%) also had comorbidity for overweight and blood lipid abnormalities (14% for triglycerides, 44.7% for TC, 25.9% for LDL-C, 52% for low HDL-C). The present study shows for the first time high correlations between prehypertensive blood pressure levels and the cardiovascular risk factors high TC, high LDL-C, low HDL-C in schoolchildren. These are important for the formulation of public health policies and strategies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The introduction of routine vaccination against tetanus and diphtheria in Brazil has decreased the incidence and changed the epidemiology of both diseases. We then investigated the prevalence of Corynebacterium diphtheriae carrier status and diphtheria and tetanus immunity in São Paulo, Brazil. From November 2001 to March 2003, 374 individuals were tested for the presence of C. diphtheriae in the naso-oropharynx and of serum diphtheria and tetanus antibodies. Participants were all healthy individuals without acute or chronic pathologies and they were stratified by age as follows: 0-12 months and 1-4, 5-9, 10-14, 15-24, 25-39, 40-59, and ³60 years. Antibodies were assessed using a double-antigen ELISA. C. diphtheriae species were identified by biochemical analysis and toxigenicity was assessed by the Elek test. For diphtheria, full protection (antibodies ³0.1 IU/mL) was present in 84% of the individuals, 15% had basic protection (antibodies ³0.01 and <0.1 IU/mL) and 1% were susceptible (antibodies <0.01 IU/mL). Full tetanus protection (antibodies ³0.1 IU/mL) was present in 79% of the participants, 18% had basic protection (antibodies ³0.01 and <0.1 IU/mL) and 3% were susceptible (antibodies <0.01 IU/mL). The geometric mean of diphtheria and tetanus antibodies reached the highest values at 5-9 years and decreased until the 40-59-year age range, increasing again in individuals over 60 years. Three participants (0.8%) were carriers of C. diphtheriae, all non-toxigenic strains. The present results demonstrate the clear need of periodic booster for tetanus and diphtheria vaccine in adolescents and adults after primary immunization in childhood.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1887/10/14 (N3828,A11).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1923/10/14 (A49,N16875).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1916/10/14 (N14327,A59).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1894/10/14 (N844,A11).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1897/10/14 (N7480,A21).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A gelatinização é uma importante propriedade funcional das proteínas alimentares, devido ao seu grande potencial de uso nos alimentos estruturados. As proteínas da clara do ovo de galinha têm sido extensivamente usadas como ingredientes em alimentos processados. O objetivo deste trabalho foi avaliar as mudanças no pH, no perfil de textura e na umidade espremível de géis de clara de ovos de galinha com e sem cobertura de concentrado protéico de soro de leite, armazenados a 25ºC, por 3, 7, 10, 14, 21 e 28 dias. A dureza do gel do albume de ovos sem cobertura foi maior do que a de ovos recobertos, durante todos os períodos de armazenamento. Não houve efeito do tempo de armazenamento na dureza dos géis dos ovos sem cobertura. Em ovos cobertos, a regressão linear explicou 60% do comportamento da dureza em relação ao período de armazenamento. No caso da elasticidade, não houve interação entre período de armazenamento e a cobertura. Houve diferença entre as médias dentro de cada período, mas não durante o armazenamento. A maior elasticidade foi dos géis de ovos sem cobertura, comparados com os géis de ovos recobertos. O índice de coesividade e a mastigabilidade de géis de ovos sem cobertura foi maior que o de géis de ovos recobertos, em todos os períodos de armazenamento. A percentagem de umidade espremível (UE) de géis de clara de ovos recobertos foi maior do que a de ovos sem cobertura em todo o período de estocagem.