876 resultados para Knightian preferences


Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper presents a personal view of the interaction between the analysis of choice under uncertainty and the analysis of production under uncertainty. Interest in the foundations of the theory of choice under uncertainty was stimulated by applications of expected utility theory such as the Sandmo model of production under uncertainty. This interest led to the development of generalized models including rank-dependent expected utility theory. In turn, the development of generalized expected utility models raised the question of whether such models could be used in the analysis of applied problems such as those involving production under uncertainty. Finally, the revival of the state-contingent approach led to the recognition of a fundamental duality between choice problems and production problems.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The thermal ecology and structural habitat use of two closely related sympatric lizards, Carlia vivax (de Vis) and Lygisaurus foliorum de Vis, were examined in an open sclerophyll forest in subtropical Australia. Comparable mean body temperatures (T-b) and habitat temperatures (T-hab) at the point of capture were recorded for both species. However, sex- related differences in the thermal variables for C. vivax, with females displaying higher temperatures than males, resulted in some significant differences in T-b and T-hab between the species. Variation in T-b and T-hab within and between species was unrelated to time of capture. The difference in T-hab within C. vivax suggested that females were selecting warmer thermal environments than males. Both C. vivax and L. foliorum used most structural features of their habitat randomly as indicated by a similarity in canopy, shrub, ground, log and litter cover and litter depth between habitat surveys and random surveys. However, C. vivax displayed a preference for ground vegetation (height

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper presents an agent-based approach to modelling individual driver behaviour under the influence of real-time traffic information. The driver behaviour models developed in this study are based on a behavioural survey of drivers which was conducted on a congested commuting corridor in Brisbane, Australia. Commuters' responses to travel information were analysed and a number of discrete choice models were developed to determine the factors influencing drivers' behaviour and their propensity to change route and adjust travel patterns. Based on the results obtained from the behavioural survey, the agent behaviour parameters which define driver characteristics, knowledge and preferences were identified and their values determined. A case study implementing a simple agent-based route choice decision model within a microscopic traffic simulation tool is also presented. Driver-vehicle units (DVUs) were modelled as autonomous software components that can each be assigned a set of goals to achieve and a database of knowledge comprising certain beliefs, intentions and preferences concerning the driving task. Each DVU provided route choice decision-making capabilities, based on perception of its environment, that were similar to the described intentions of the driver it represented. The case study clearly demonstrated the feasibility of the approach and the potential to develop more complex driver behavioural dynamics based on the belief-desire-intention agent architecture. (C) 2002 Elsevier Science Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Producer decisionmaking under uncertainty is characterized using indirect objective functions. The characterization is for the class of producers with continuous and nondecreasing preferences over stochastic incomes who face both price and production uncertainty. (C) 2002 Elsevier Science B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this paper, it is shown that, for a wide range of risk-averse generalized expected utility preferences, independent risks are complementary, contrary to the results for expected utility preferences satisfying conditions such as proper and standard risk aversion.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A stable matching rule is used as the outcome function for the Admission game where colleges behave straightforwardly and the students` strategies are given by their preferences over the colleges. We show that the college-optimal stable matching rule implements the set of stable matchings via the Nash equilibrium (NE) concept. For any other stable matching rule the strategic behavior of the students may lead to outcomes that are not stable under the true preferences. We then introduce uncertainty about the matching selected and prove that the natural solution concept is that of NE in the strong sense. A general result shows that the random stable matching rule, as well as any stable matching rule, implements the set of stable matchings via NE in the strong sense. Precise answers are given to the strategic questions raised.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

An important segmentation basis used by firms is related to consumers` personal values which are investigated in this study. It was used a descriptive research with the survey method of data collection in a sample of executives from Sao Paulo who are considered to be potential buyers of high value and innovative goods. An exploratory factor analysis was employed in order to reduce the values scale used and a cluster analysis was performed to identify the groups of executives according to the importance attached to different person values. Concluding, it was observed that there was a similarity among the three personal values dimensions, named as Civility (concerns about having a good conduct before society according to social rules of interaction), Self-Direction (intellectual aspects and practical orientation in their conducts) and Conformity (restriction of actions, inclinations and impulses, that are likely to harm others and would violate expectations) and the ones reported in the theory Rokeach`s theory about instrumental personal values. Furthermore, three groups of executives were identified (good conduct group, low restriction group and high restriction group). The differences observed in the importance of personal values here presented by the dimensions called Civility, Self-Direction and Conformity can lead to different buying behaviors and product preferences. From the results found in this study the companies could adapt their current and new products offers, as well as their communication in order to better serve these segments of executives from Sao Paulo.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The object of this study is to assess informative possibilities of some technical indicators of the Test of Photos of Professions (BBT - Berufsbilder test), a projective method to clarify professional inclination, proposed by Martin Achtnich. This psychological evaluation technique is composed of 96 photos of professionals, performing various types of activities. The test subject classifies the photos into three groups: positive (agreeable), negative (disagreeable) and indifferent (neutral). Among those chosen positively, five preferences are chosen and a story is developed that includes them, an activity that is requested two times during the Vocational Guidance process: in the beginning (or middle) and at the end of the intervention. In this study, 160 stories were created by 80 youths, between 15 and 20 years of age, in public and private schools in a mid-sized Brazilian city. The stories were compared in three analytical categories: protagonist, professional conflict and resolution. The results were submitted to Wilcoxon nonparametric statistical analysis (p < .05), significant and relevant indicators of resolution being found in the process of occupational choice. This technical resource was shown, from this empirical evidence, to be promising for use in evaluation of intervention processes of Vocational Guidance.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Understanding the role of multiple colour signals during sexual signalling is a central theme in animal communication. We quantified the role of multiple colour signals (including ultraviolet, UV), measures of body size and testosterone levels in settling disputes between male rivals in an elaborately ornamented, African lizard, played out in a large 'tournament' in the wild. The hue and brightness (total reflectance) of the UV throat in Augrabies flat lizards, Platysaurus broadleyi, as well as body size, were consistent and strong predictors of 'fighting ability'. Males with high fighting ability were larger and displayed a UV throat with low total reflectance. In contrast, males with low fighting ability were smaller and had violet throats with broader spectral reflectance curves (higher total reflectance). As fighting ability is associated with alternative reproductive tactics in this system (territorial versus floater), we also examined the role of colour signals in predicting male reproductive tactic. Territorial males had UV throats with higher chroma but had poorer body condition than floater males, probably because of the energetic costs of maintaining a territory. Although testosterone was not a significant predictor of fighting ability or reproductive tactic, it was correlated with the hue of the UV throat, suggesting that testosterone may impose some constraint on signal expression. Lastly, we show that within the context of the natural signalling environment, UV-reflective throats constitute a conspicuous, effective signal that male Augrabies flat lizards use to advertise their status honestly to rivals. (c) 2006 The Association for the Study of Animal Behaviour. Published by Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Introduction. Previous research has demonstrated that sildenafil citrate users alter dosing-sexual attempt behavior when switched to tadalafil. The impact of geography and culture on sexual behavior with phosphodiesterase type 5 (PDE5) inhibitor treatment has not been fully investigated. Aim. To describe and compare the changes in dosing-sexual attempt behavior with sildenafil citrate vs. tadalafil treatment across four distinct geographies: Asia, Australia/New Zealand (ANZ), Central Eastern Europe/Middle East (CEE/ME), and Latin America (LA). Methods. Data from a single-arm, open-label clinical trial conducted in 21 countries from November 2002 to May 2004 were used in this analysis. Men with erectile dysfunction and a history of >= 6-week prior sildenafil citrate use continued sildenafil citrate treatment for 4 weeks then switched to tadalafil for 8 weeks. Dosing instructions were provided. Main Outcomes Measures. Timing of dose and sexual intercourse was assessed through patient diaries for the final 4 weeks of each treatment period. Results. A total of 2,760 men were enrolled: Asia 15.8%; ANZ 29.4%; CEE/ME 19.7%; LA 35.1%. The median time from dosing to intercourse was significantly increased during tadalafil treatment across all geographical regions; however, the magnitude of increase differed significantly by geography (P < 0.0001). The Asian cohort demonstrated the shortest duration between dosing and sexual intercourse attempts (irrespective of drug), and altered sexual behavior the least upon switching to tadalafil. The ANZ cohort demonstrated the longest duration between dosing and sexual intercourse attempts (irrespective of drug), and altered sexual behavior the most upon switching to tadalafil. Conclusion. Men with a history of established sildenafil citrate use alter their dose-attempt behavior when treated with tadalafil irrespective of geography. However, the extent to which sexual behavior alters is not uniform across geographical regions, suggesting that dosing instructions and duration of drug effectiveness, in combination with personal and cultural preferences, may determine sexual behavior with PDE5 inhibitor use. Rubio-Aurioles E, Glina S, Abdo CHN, Hernandez-Serrano R, Rampazzo C, Sotomayor M, West TM, Gallagher GL, and Lenero E. Timing of dose relative to sexual intercourse attempt in previous sildenafil citrate users treated with tadalafil: A geographical comparison from a single arm, open-label study. J Sex Med 2009;6:2836-2850.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this paper we present a new neuroeconomics model for decision-making applied to the Attention-Deficit/Hyperactivity Disorder (ADHD). The model is based on the hypothesis that decision-making is dependent on the evaluation of expected rewards and risks assessed simultaneously in two decision spaces: the personal (PDS) and the interpersonal emotional spaces (IDS). Motivation to act is triggered by necessities identified in PDS or IDS. The adequacy of an action in fulfilling a given necessity is assumed to be dependent on the expected reward and risk evaluated in the decision spaces. Conflict generated by expected reward and risk influences the easiness (cognitive effort) and the future perspective of the decision-making. Finally, the willingness (not) to act is proposed to be a function of the expected reward (or risk), adequacy, easiness and future perspective. The two most frequent clinical forms are ADHD hyperactive (AD/HDhyp) and ADHD inattentive (AD/HDdin). AD/HDhyp behavior is hypothesized to be a consequence of experiencing high rewarding expectancies for short periods of time, low risk evaluation, and short future perspective for decision-making. AD/HDin is hypothesized to be a consequence of experiencing high rewarding expectancies for long periods of time, low risk evaluation, and long future perspective for decision-making.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Here we investigated the possible association between the carboxypeptidase A (CPA)-like activity of the rat mesenteric arterial bed (MAB) perfusate and the ability of this fluid of forming angiotensin (Ang) 1-9 and Ang 1-7 upon incubation with Ang I and Ang II, respectively. Initially, we observed that anion exchange chromatography of the perfusate would consistently split the characteristic Z-Val-Phe-hydrolyzing activity of CPA-like enzymes into five distinct peaks, whose proteolytic activities were then determined using also Ang I and Ang II as substrates. The resulting proteolytic profile for each peak indicated that rat MAB perfusate contains a complex mixture of carboxypeptidases; tentatively, five carboxypeptidases were distinguished based on their substrate preferences toward Z-Val-Phe. Ang I and Ang II. The respective reactions, namely, Z-Val-Phe cleavage, Ang I to Ang 1-9 conversion and Ang II to Ang 1-7 conversion, were inhibited by 1,10-phenanthroline and nearly fully blocked by potato carboxypeptidase inhibitor. Also, all the CPA-like activity peaks prepared by anion exchange chromatography were tested negative for contaminating Ang I-converting enzyme-2, cathepsin A and prolylcarboxypeptidase. Overall, our results indicate that rat MAB perfusate contains a multiplicity of Ang I and Ang II-processing CPA-like enzymes whose proteolytic specificities suggest they might perform peculiar regulatory roles in the local resin-angiotensin system. (C) 2008 Elsevier B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The number of people aged 65 years or over in low-income rental households will more than double by 2026. The social housing system, at its current growth rate, will not meet their needs. This research involved demographic projections of older renters, examined their housing preferences, and analysed the supply capacity of the public and private rental sectors to respond.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Global biodiversity loss and its consequences for human welfare and sustainable development have become major concerns. Economists have, therefore, given increasing attention to the policy issues involved in the management of genetic resources. To do so, they often apply empirical methods developed in behavioral and experimental economics to estimate economic values placed on genetic resources. This trend away from almost exclusive dependence on axiomatic methods is welcomed. However, major valuation methods used in behavioral economics raise new scientific challenges. Possibly the most important of these include deficiencies in the knowledge of the public (and researchers) about genetic resources, implications for the formation of values of supplying information to focal individuals, and limits to rationality. These issues are explored for stated-preference techniques of valuation (e.g., contingent valuation) as well as revealed preference techniques, especially the travel cost method. They are illustrated by Australian and Asian examples. Taking into account behavioral and psychological models and empirical evidence, particular attention is given to how elicitation of preferences, and supply of information to individuals, influences their preferences about biodiversity. Policy consequences are outlined.