985 resultados para Equimultiple Locus


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Restricted cochlear lesions in adult animals result in plastic changes in the representation of the lesioned cochlea, and thus in the frequency map, in the contralateral auditory cortex and thalamus. To examine the contribution of subthalamic changes to this reorganization, the effects of unilateral mechanical cochlear lesions on the frequency organization of the central nucleus of the inferior colliculus (ICC) were examined in adult cats. Lesions typically resulted in a broad high-frequency hearing loss extending from a frequency in the range 15-22 kHz. After recovery periods of 2.5-18 months, the frequency organization of ICC contralateral to the lesioned cochlea was determined separately for the onset and late components of multiunit responses to tone-burst stimuli. For the late response component in all but one penetration through the ICC, and for the onset response component in more than half of the penetrations, changes in frequency organization in the lesion projection zone were explicable as the residue of prelesion responses. In half of the penetrations exhibiting nonresidue type changes in onset-response frequency organization, the changes appeared to reflect the unmasking of normally inhibited inputs. In the other half it was unclear whether the changes reflected unmasking or a dynamic process of reorganization. Thus, most of the observed changes were explicable as passive consequences of the lesion, and there was limited evidence for plasticity in the ICC. The implications of the data with respect to the primary locus of the changes and to the manner in which they contribute to thalamocortical reorganization are considered. (C) 2003 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Diverse self-incompatibility (SI) mechanisms permit flowering plants to inhibit fertilization by pollen that express specificities in common with the pistil. Characteristic of at least two model systems is greatly reduced recombination across large genomic tracts surrounding the S-locus, which regulates SI. In three angiosperm families, including the Solanaceae, the gene that controls the expression of gametophytic SI in the pistil encodes a ribonuclease (S-RNase). The gene that controls pollen SI expression is currently unknown, although several candidates have recently been proposed. Although each candidate shows a high level of polymorphism and complete allelic disequilibrium with the S-RNase gene, such properties may merely reflect tight linkage to the S-locus, irrespective of any functional role in SI. We analyzed the magnitude and nature of nucleotide variation, with the objective of distinguishing likely candidates for regulators of SI from other genes embedded in the S-locus region. We studied the S-RNase gene of the Solanaceae and 48A, a candidate for the pollen gene in this system, and we also conducted a parallel analysis of the regulators of sporophytic SI in Brassica, a system in which both the pistil and pollen genes are known. Although the pattern of variation shown by the pollen gene of the Brassica system is consistent with its role as a determinant of pollen specificity, that of 48A departs from expectation. Our analysis further suggests that recombination between 48A and S-RNase may have occurred during the interval spanned by the gene genealogy, another indication that 48A may not regulate SI expression in pollen.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have measured nucleotide variation in the CLOCK/CYCLE heterodimer inhibition domain (CCID) of the clock X-linked gene period in seven species belonging to the Drosophila buzzatii cluster, namely D. buzzatii, Drosophila koepferae, Drosophila antonietae, Drosophila serido, Drosophila gouveai, Drosophila seriema and Drosophila borborema. We detected that the purifying selection is the main force driving the sequence evolution in period, in agreement with the important role of CCID in clock machinery. Our survey revealed that period provides valuable phylogenetic information that allowed to resolve phylogenetic relationships among D. gouveai, D. borborema and D. seriema, which composed a polytomic clade in preliminary studies. The analysis of patterns of intraspecific variation revealed two different lineages of period in D. koepferae, probably reflecting introgressive hybridization from D. buzzatii, in concordance with previous molecular data.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Drosophila antonietae and Drosophila gouveai are allopatric, cactophilic, cryptic and endemic of South America species, which aedeagus morphology is considered the main diagnostic character. In this work, single close populations from the edge distributions of each species, located in an ""introgressive corridor"", were analyzed regarding temporal isozenzymatic genetic variability. Isocitrate dehydrogenase (Idh) appeared as a diagnostic locus between D. antonieate and D. gouveai because each population was fixed for different alleles. Moreover, several polymorphic loci showed accentuated divergence in the allele frequency, as evidenced by Nei`s l(0.3188) and D (1.1432), and also by Reynolds` genetic distance and identity (1.3207 and 0.7331, respectively). Our results showed that, in spite of the very similar external morphology, related evolutionary histories, close distributions, and events of introgression in the studied area, these cryptic species have high allozymatic differentiation, and this is discussed here. (C) 2010 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: Familial partial epilepsy with variable foci (FPEVF) is an autosomal dominant syndrome characterized by partial seizures originating from different brain regions in different family members in the absence of detectable structural abnormalities. A gene for FPEVF was mapped to chromosome 22q12 in two distantly related French-Canadian families. Methods: We describe the clinical features and performed a linkage analysis in a Spanish kindred and in a third French-Canadian family distantly related to the original pedigrees. Results: Onset of seizures was typically in middle childhood, and attacks were usually easy to control. Seizure semiology varied among family members but was constant for each individual. In some, a pattern of nocturnal frontal lobe seizures led to consideration of the diagnosis of autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE). The Spanish family was mapped to chromosome 22q (multipoint lod score, 3.4), and the new French-Canadian family had a multipoint lod score of 2.97 and shared the haplotype of the original French-Canadian families. Conclusions: Identification of the various forms of familial partial epilepsy is challenging, particularly in small families, in which insufficient individuals exist to identify a specific pattern. We provide clinical guidelines for this task, which will eventually be supplanted by specific molecular diagnosis. We confirmed linkage of FPEVF to chromosome 22q 12 and redefined the region to a 5.2-Mb segment of DNA.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Progressive myoclonus epilepsy (PME) has a number of causes, of which Unverricht-Lundborg disease (ULD) is the most common. ULD has previously been mapped to a locus on chromosome 21 (EPM1). Subsequently, mutations in the cystatin B gene have been found in most cases. In the present work we identified an inbred Arab family with a clinical pattern compatible with ULD, but mutations in the cystatin B gene were absent. We sought to characterize the clinical and molecular features of the disorder. The family was studied by multiple field trips to their town to clarify details of the complex consanguineous relationships and to personally examine the family. DNA was collected for subsequent molecular analyses from 21 individuals. A genome-wide screen was performed using 811 microsatellite markers. Homozygosity mapping was used to identify loci of interest. There were eight affected individuals. Clinical onset was at 7.3 +/- 1.5 years with myoclonic or tonic-clonic seizures. All had myoclonus that progressed in severity over time and seven had tonic-clonic seizures. Ataxia, in addition to myoclonus, occurred in all. Detailed cognitive assessment was not possible, but there was no significant progressive dementia. There was intrafamily variation in severity; three required wheelchairs in adult life; the others could walk unaided. MRI, muscle and skin biopsies on one individual were unremarkable. We mapped the family to a 15-megabase region at the pericentromeric region of chromosome 12 with a maximum lod score of 6.32. Although the phenotype of individual subjects was typical of ULD, the mean age of onset (7.3 years versus 11 years for ULD) was younger. The locus on chromosome 12 does not contain genes for any other form of PME, nor does it have genes known to be related to cystatin B. This represents a new form of PME and we have designated the locus as EPM1B.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Withdrawal from morphine leads to the appearance of extreme anxiety accompanied of several physical disturbances, most of them linked to the activation of brainstem regions such as the locus coeruleus, ventral tegmental area, hypothalamic nuclei and periaqueductal grey (PAG). As anxiety remains one of the main components of morphine withdrawal the present study aimed to evaluating the influence of the dorsal aspects of the PAG on the production of this state, since this structure is well-known to be involved in defensive behaviour elicited by anxiety-evoking stimuli. Different groups of animals were submitted to 10 days of i.p. morphine injections, challenged 2 h after with an i.p. injection of naloxone (0.1 mg/kg), and submitted to the plus-maze, open-field and light-dark transition tests. The effects of morphine withdrawal on anxiety-induced Fos immunolabelling were evaluated in four animals that passed by the light-dark transition test randomly chosen for Fos-protein analysis. Besides the PAG, Fos neural expression was conducted in other brain regions involved in the expression of anxiety-related behaviours. Our results showed that morphine withdrawn rats presented enhanced anxiety accompanied of few somatic symptoms. Increased Fos immunolabelling was noted in brain regions well-known to modulate these states as the prelimbic cortex, nucleus accumbens, amygdala and paraventricular hypothalamus. Increased Fos labelling was also observed in the ventral and dorsal aspects of the PAG, a region involved in anxiety-related processes suggesting that this region could be a common neural substrate enlisted during anxiety evoked by dangerous stimuli as well as those elicited by opiate withdrawal. (c) 2008 Elsevier Inc. All rights reserved,

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Little attention has been given to the contextual politics of service delivery reforms. By focusing on cases of reform in the healthcare sector and, to a lesser extent, in the main policies in the social service sector in India, Mexico and Brazil, this article explores two dimensions of analysis which have enormous relevance in understanding the reach and effectiveness of service delivery reforms: (1) the historical timing of reforms and sectorial baselines, and (2) the degree and institutional locus of local discretion in policy. Findings show that depending on both dimensions, there is an extraordinary variation as to the degree, interests involved and meaning of changes which, in theory, correspond to these countries` commitment to the service delivery reforms, However, consideration of the contextual politics is relevant not for the sake of diversity but for the similarities that this diversity reveals, pointing to underlying analytic dimensions that receive attention in this article.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Mutations in the Grb10-interacting GYF protein 2 (GIGYF2) gene, within the PARK11 locus, have been nominated as a cause of Parkinson`s disease in Italian and French populations. By sequencing the whole GIGYF2 coding region in forty-six probands (thirty-seven Italians) with familial Parkinson`s disease compatible with an autosomal dominant inheritance, we identified no mutations. Our data add to a growing body of evidence suggesting that GIGYF2 mutations are not a frequent cause of PD. (C) 2009 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Context: Genetic polymorphisms at the perilipin (PLIN) locus have been investigated for their potential utility as markers for obesity and metabolic syndrome (MS). We examined in obese children and adolescents (OCA) aged 7-14 yr the association of single-nucleotide polymorphisms (SNP) at the PLIN locus with anthropometric, metabolic traits, and weight loss after 20-wk multi-disciplinary behavioral and nutritional treatment without medication. Design: A total of 234 OCA [body mass index (BMI = 30.4 +/- 4.4 kg/m(2); BMI Z-score = 2.31 +/- 0.4) were evaluated at baseline and after intervention. We genotyped four SNPs (PLIN1 6209T -> C, PLIN4 11482G -> A, PLIN5 13041A -> G, and PLIN6 14995A -> T). Results: Allele frequencies were similar to other populations, PLIN1 and PLIN4 were in linkage disequilibrium (D` = 0.999; P < 0.001). At baseline, no anthropometric differences were observed, but minor allele A at PLIN4 was associated with higher triglycerides (111 +/- 49 vs. 94 +/- 42 mg/dl; P = 0.003), lower high-density lipoprotein cholesterol (40 +/- 9 vs. 44 +/- 10 mg/dl; P = 0.003) and higher homeostasis model assessment for insulin resistance (4.0 +/- 2.3 vs. 3.5 +/- 2.1; P +/- 0.015). Minor allele A at PLIN4 was associated with MS risk (age and sex adjusted) hazard ratio 2.4 (95% confidence interval = 1.1-4.9) for genotype GA and 3.5 (95% confidence interval = 1.2-9.9) for AA. After intervention, subjects carrying minor allele T at PLIN6 had increased weight loss (3.3 +/- 3.7 vs. 1.9 +/- 3.4 kg; P = 0.002) and increased loss of the BMI Z-score (0.23 +/- 0.18 vs. 0.18 +/- 0.15; P +/- 0.003). Due to group size, risk of by-chance findings cannot be excluded. Conclusion: The minor A allele at PLIN4 was associated with higher risk of MS at baseline, whereas the PLIN6 SNP was associated with better weight loss, suggesting that these polymorphisms may predict outcome strategies based on multidisciplinary treatment for OCA. (J Clin Endocrinol Metab 93: 4933-4940, 2008)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

P>Approximately 50% of all carriers of 2q21-q31 deletions present epileptic seizures. The band 2q24 constitutes the smallest commonly deleted segment in these patients, and contains the voltage-gated sodium channel genes SCN1A and SCN2A, associated with Dravet syndrome and benign familial neonatal-infantile seizures, respectively. A further putative locus involving epilepsy in the region was previously identified through disruption of the SLC4A10 gene by translocation. In the course of performing high-resolution DNA copy number analyses on syndromic mentally impaired individuals, we encountered three patients with overlapping deletions in chromosome region 2q24. Two of these patients exhibited epileptic seizures in addition to mental deficiency. The deletion in one of the epileptic patients did not include the SCN cluster, demonstrating that a less severe form of epilepsy maps to an adjacent genomic region. This second region comprises about 3 Mb and contains the candidate gene SLC4A10, providing further support for the potential role of this gene in epilepsy.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Tissue damage in the kidney and brain after systemic infection with Candida albicans was examined in recombinant inbred strains (AKXL) derived from AKR and C57/L progenitors. Nine of the 15 strains showed mild (C57/L-like) tissue damage. Of the remainder, two strains developed lesions comparable to the AKR parental strain, whereas four exhibited a much move severe pattern of tissue damage. This was characterized by pronounced mycelial growth in the brain, and gross oedema of the kidney, with extensive fungal colonization and marked tissue destruction. The presence of the null allele of the haemolytic complement gene (Hc) may be necessary but not sufficient, for the expression of the very severe lesions. The results were interpreted as reflecting the actions of two independent genes, which have been designated Carg1 and Carg2 (Candida albicans resistance genes 1 and 2). (C) 1997 Academic Press Limited.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Angiotensinogen (AGT) gene polymorphisms have been linked to increased risk of hypertension, but the data remain controversial. In this study we review the most commonly investigated polymorphisms at the AGT locus (other than M235T) and provide summary estimates regarding their association with essential hypertension, while addressing heterogeneity, as well as publication biases. Data on 26 818 subjects from 46 studies for the 4 most-studied AGT variants (T174M in exon 2 and 3 promoter variants: A-6G, A-20C, and G-217A) were meta-analyzed. Statistically significant associations with hypertension were identified for the T174M ( odds ratio [OR]: 1.19; 95% CI: 1.07 to 1.33; P = 0.002) and G-217A (OR: 1.37; 95% CI: 1.17 to 1.59; P = 0.00006) polymorphisms. A dual but consistent effect was observed for the -20C allele, which was associated with a decreased risk of hypertension in populations of mixed and European ancestries (OR: 0.64; 95% CI: 0.44 to 0.92; P = 0.02 and OR: 0.77; 95% CI: 0.65 to 0.91; P = 0.003, respectively), but with a 24% increase in the odds of hypertension in Asian subjects (OR: 1.24; 95% CI: 1.04 to 1.48; P = 0.02). No association of the A-6G variant with hypertension was detected. Current studies support the notion that single variants at the AGT might modulate the risk of hypertension but indicate caution in interpreting these results because of the putative presence of publication bias and gene-environment interactions.