Evaluation of renal function in sickle cell disease patients in Brazil

The objective of this study was to investigate renal function in a cohort of 98 patients with sickle cell disease (SCD) followed up at a tertiary hospital in Brazil. Clinical and laboratory characteristics at the time of the most recent medical examination were analyzed. Renal function was evaluated by the estimation of glomerular filtration rate (GFR) by the criteria of the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI). We compared patients with normal GFR to patients with decreased GFR (<60 mL·min-1·(1.73 m²)-1) and hyperfiltration (>120 mL·min-1·(1.73 m²)-1). Comparison between patients according to the use of hydroxyurea and comparison of clinical and laboratory parameters according to GFR were also carried out. Average patient age was 33.8 ± 13.3 years (range 19-67 years), and 57 (58.1%) patients were females. The comparison of patients according to GFR showed that patients with decreased GFR (<60 mL·min-1·(1.73 m²)-1) were older, had lower levels of hematocrit, hemoglobin and platelets and higher levels of urea and creatinine. Independent risk factors for decreased GFR were advanced age (OR = 21.6, P < 0.0001) and anemia (OR = 39.6, P < 0.0001). Patients with glomerular hyperfiltration tended to be younger, had higher levels of hematocrit, hemoglobin and platelets and lower levels of urea and creatinine, with less frequent urinary abnormalities. Hydroxyurea, at the dosage of 500-1000 mg/day, was being administered to 28.5% of the patients, and there was no significant difference regarding renal function between the two groups. Further studies are required to establish the best therapeutic approach to renal abnormalities in SCD.

Effect of eccentric training on mitochondrial function and oxidative stress in the skeletal muscle of rats

The objective of the present study was to investigate the effects of eccentric training on the activity of mitochondrial respiratory chain enzymes, oxidative stress, muscle damage, and inflammation of skeletal muscle. Eighteen male mice (CF1) weighing 30-35 g were randomly divided into 3 groups (N = 6): untrained, trained eccentric running (16°; TER), and trained running (0°) (TR), and were submitted to an 8-week training program. TER increased muscle oxidative capacity (succinate dehydrogenase and complexes I and II) in a manner similar to TR, and TER did not decrease oxidative damage (xylenol and creatine phosphate) but increased antioxidant enzyme activity (superoxide dismutase and catalase) similar to TR. Muscle damage (creatine kinase) and inflammation (myeloperoxidase) were not reduced by TER. In conclusion, we suggest that TER improves mitochondrial function but does not reduce oxidative stress, muscle damage, or inflammation induced by eccentric contractions.

Cardiorespiratory fitness, pulmonary function and C-reactive protein levels in nonsmoking individuals with diabetes

The objective of this study was to evaluate cardiorespiratory fitness and pulmonary function and the relationship with metabolic variables and C-reactive protein (CRP) plasma levels in individuals with diabetes mellitus (DM). Nineteen men with diabetes and 19 age- and gender-matched control subjects were studied. All individuals were given incremental cardiopulmonary exercise and pulmonary function tests. In the exercise test, maximal workload (158.3±22.3vs 135.1±25.2, P=0.005), peak heart rate (HRpeak: 149±12 vs 139±10, P=0.009), peak oxygen uptake (VO2peak: 24.2±3.2 vs18.9±2.8, P<0.001), and anaerobic threshold (VO2VT: 14.1±3.4 vs 12.2±2.2, P=0.04) were significantly lower in individuals with diabetes than in control subjects. Pulmonary function test parameters, blood pressure, lipid profile (triglycerides, HDL, LDL, and total cholesterol), and CRP plasma levels were not different in control subjects and individuals with DM. No correlations were observed between hemoglobin A1C (HbA1c), CRP and pulmonary function test and cardiopulmonary exercise test performance. In conclusion, the results demonstrate that nonsmoking individuals with DM have decreased cardiorespiratory fitness that is not correlated with resting pulmonary function parameters, HbA1c, and CRP plasma levels.

Serotonin regulates osteoblast proliferation and function in vitro

The monoamine serotonin (5-hydroxytryptamine, 5-HT), a well-known neurotransmitter, also has important functions outside the central nervous system. The objective of this study was to investigate the role of 5-HT in the proliferation, differentiation, and function of osteoblasts in vitro. We treated rat primary calvarial osteoblasts with various concentrations of 5-HT (1 nM to 10 µM) and assessed the rate of osteoblast proliferation, expression levels of osteoblast-specific proteins and genes, and the ability to form mineralized nodules. Next, we detected which 5-HT receptor subtypes were expressed in rat osteoblasts at different stages of osteoblast differentiation. We found that 5-HT could inhibit osteoblast proliferation, differentiation, and mineralization at low concentrations, but this inhibitory effect was mitigated at relatively high concentrations. Six of the 5-HT receptor subtypes (5-HT1A, 5-HT1B, 5-HT1D, 5-HT2A, 5-HT2B, and 5-HT2C) were found to exist in rat osteoblasts. Of these, 5-HT2A and 5-HT1Breceptors had the highest expression levels, at both early and late stages of differentiation. Our results indicated that 5-HT can regulate osteoblast proliferation and function in vitro.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Correlation between heart rate variability and pulmonary function adjusted by confounding factors in healthy adults

The autonomic nervous system maintains homeostasis, which is the state of balance in the body. That balance can be determined simply and noninvasively by evaluating heart rate variability (HRV). However, independently of autonomic control of the heart, HRV can be influenced by other factors, such as respiratory parameters. Little is known about the relationship between HRV and spirometric indices. In this study, our objective was to determine whether HRV correlates with spirometric indices in adults without cardiopulmonary disease, considering the main confounders (e.g., smoking and physical inactivity). In a sample of 119 asymptomatic adults (age 20-80 years), we evaluated forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV1). We evaluated resting HRV indices within a 5-min window in the middle of a 10-min recording period, thereafter analyzing time and frequency domains. To evaluate daily physical activity, we instructed participants to use a triaxial accelerometer for 7 days. Physical inactivity was defined as <150 min/week of moderate to intense physical activity. We found that FVC and FEV1, respectively, correlated significantly with the following aspects of the RR interval: standard deviation of the RR intervals (r =0.31 and 0.35), low-frequency component (r =0.38 and 0.40), and Poincaré plot SD2 (r =0.34 and 0.36). Multivariate regression analysis, adjusted for age, sex, smoking, physical inactivity, and cardiovascular risk, identified the SD2 and dyslipidemia as independent predictors of FVC and FEV1 (R2=0.125 and 0.180, respectively, for both). We conclude that pulmonary function is influenced by autonomic control of cardiovascular function, independently of the main confounders.

Defining Sales and Operations Planning Process in an Environmental Management Company

Sales and operations research publications have increased significantly in the last decades. The concept of sales and operations planning (S&OP) has gained increased recognition and has been put forward as the area within Supply Chain Management (SCM). Development of S&OP is based on the need for determining future actions, both for sales and operations, since off-shoring, outsourcing, complex supply chains and extended lead times make challenges for responding to changes in the marketplace when they occur. Order intake of the case company has grown rapidly during the last years. Along with the growth, new challenges considering data management and information flow have arisen due to increasing customer orders. To manage these challenges, case company has implemented S&OP process, though initial process is in early stage and due to this, the process is not managing the increased customer orders adequately. Thesis objective is to explore extensively the S&OP process content of the case company and give further recommendations. Objectives are categorized into six different groups, to clarify the purpose of this thesis. Qualitative research methods used are active participant observation, qualitative interviews, enquiry, education, and a workshop. It is notable that demand planning was felt as cumbersome, so it is typically the biggest challenge in S&OP process. More proactive the sales forecasting can be, more expanded the time horizon of operational planning will turn out. S&OP process is 60 percent change management, 30 percent process development and 10 percent technology. The change management and continuous improvement can sometimes be arduous and set as secondary. It is important that different people are required to improve the process and the process is constantly evaluated. As well as, process governance is substantially in a central role and it has to be managed consciously. Generally, S&OP process was seen important and all the stakeholders were committed to the process. Particular sections were experienced more important than others, depending on the stakeholders’ point of views. Recommendations to objective groups are evaluated by the achievable benefit and resource requirement. The urgent and easily implemented improvement recommendations should be executed firstly. Next steps are to develop more coherent process structure and refine cost awareness. Afterwards demand planning, supply planning, and reporting should be developed more profoundly. For last, information technology system should be implemented to support the process phases.

Oxidative enzymes activity in sugarcane juice as a function of the planting system

In Brazil, the largest producer of sugarcane in the world, the industrial process transforms this crop into ethanol and/or granulated sugar. Some cultivars exhibit enzymatic browning in the extracted sugarcane juice at levels harmful to the manufacturing process of white granulated sugar. The objective of this study was to assess the effect of sugarcane straw used as soil coverage, the use of different planting systems, and treatments with hydrogel polymer on enzymatic activity. The cultivar RB 86 7515 was sampled for 8 months; the first sample was obtained by cutting the upper portion of the stalk at the internode, which was taken to the laboratory for determination of the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The soil coverage with different forms of straw as well as the planting systems did not change the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The polyphenoloxidase (PPO) activity increased with the use of a polymer due to increased polyphenoloxidase (PPO) activity in the groove system. The enzymes studied showed changes in activity during the experimental period. The production of sugar at the end of the season (August to November) avoids the periods of highest enzymatic activity.

Evaluation of metabolic syndrome and associations with inflammation and graft function in renal transplant recipients

INTRODUCTION: Cardiovascular disease (CVD) is a major determinant of mortality in renal transplant recipients (RTR). Metabolic syndrome (MS) and chronic inflammation are currently considered non traditional risk factors for cardiovascular disease. This study evaluates the frequency of these conditions their associations with graft function. OBJECTIVE: To evaluate the prevalence of metabolic syndrome (MS) and inflammation and their associations with graft function in renal transplant recipients. METHODS: A cross-sectional study was carried out with 200 RTR. MS was defined by the NCEP-ATP III criteria. Inflammation was assessed by CRP levels. Renal function was assessed by GFR estimation using the MDRD equation. RESULTS: MS occurred in 71 patients (35.5%). Patients with MS had higher CPR and decreased GFR levels. Inflammation was present in 99 patients (49.5%). Mean waist perimeter, body mass index, triglycerides and serum total cholesterol were significantly higher in inflamed patients. An association between MS and inflammation was demonstrated, 48 (67.6%) patients with MS were inflamed and among those without MS the rate of inflamed patients was 39.5% (51 patients) (p < 0.001). A significantly higher percentage of patients with MS in the group of patients in chronic renal disease stages III and IV was observed. CONCLUSION: In RTR there is a significant association among MS and inflammation. MS is negatively associated with graft function. The clinical implications of these findings must be evaluated in longitudinal studies.

Histopathological analysis of pre-implantation donor kidney biopsies: association with graft survival and function in one year post-transplantation

Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.

Economic and environmental evaluation of renewable energy systems

The main objective of this thesis is to evaluate the economic and environmental effectiveness of three different renewable energy systems: solar PV, wind energy and biomass energy systems. Financial methods such as Internal Rate of Return (IRR) and Modified Internal Rate of Return (MIRR) were used to evaluate economic competitiveness. Seasonal variability in power generation capability of different renewable systems were also taken into consideration. In order to evaluate the environmental effectiveness of different energy systems, default values in GaBi software were taken by defining the functional unit as 1kWh. The results show that solar PV systems are difficult to justify both in economic as well as environmental grounds. Wind energy performs better in both economic and environmental grounds and has the capability to compete with conventional energy systems. Biomass energy systems exhibit environmental and economic performance at the middle level. In each of these systems, results vary.

EU Strategy for the Baltic Sea Region: its added value in environmental social and economic dimensions

The European Council has invited the European Commission to present the first macro-regional strategy – the EU Strategy for the Baltic Sea Region (EUSBSR) on the 14th of December 2007, primarily to address collective challenges and opportunities of the Region and also to engender cohesion in support of an European integration policy. However, macro-regional strategies conceived to aid European integration and territorial cohesion were viewed by academics with skepticism, obscuring the strategies’ potential impact. This thesis intends to investigate and measure the added value of the EUSBSR in order to analyze its impact on regional development and its feasibility as a guide for future programs intending to strengthen European cohesion and integration. To determine the added value of the EUSBSR the thesis is organized into three sections, so as to address environmental, social, and economic concerns, respectively. The first case examines EU-Russia cooperation in an environmental context to investigate how environmental cooperation with an external neighbor could forge increased cohesion in a macro-regional setting. To figure the added cooperation that academic cooperation among universities would contribute to social dimension, the work has chosen several study results. Lastly, to measure out the added value for the economic strategy objective, the study employs the project for Improved Global Competitiveness in an example of ‘A Baltic Sea Region Program for Innovation, Cluster and SME-Networks’ as an economic plan.

Expression and function of endothelin and its receptors in vascular adventitial fibroblasts

Objective: The adventitia has been recognized to play important roles in vascular oxidative stress, remodelling and contraction. We recently demonstrated that adventitial fibroblasts are able to express endothelin-1 (ET-1) in response to angiotensin II (ANG II). However, the mechanisms by which ANG II induces ET-1 expression are unknown. It is also unclear whether the ET-1 receptors are expressed in the adventitia. We therefore examined the role of oxidative stress in the regulation of ET-1. We also investigated the expression of both the ETA and ETB receptors and the roles of these two types of receptors in collagen synthesis and ET-1 clearance in adventitial fibroblasts. Methods and Results: Adventitial fibroblasts were isolated and cultured from the thoracic mouse aorta. Cells were treated with ANG II (lOOnM), ET-1 (lOpM), NADPH oxidase inhibitor apocynin (lOOfiM), the superoxide anion scavenger tempol (lOOfiM), the ANG II receptor antagonists (100[aM), losartan (AT| receptor) and PD 1233 19 (AT2 receptor), the ET-1 receptor antagonists (lOOuM), BQ123 (ETA receptor) and BQ788 (ETB receptor), and the ETB receptor agonist (lOOnM) Sarafotoxin 6C. ET-1 peptide levels were determined by ELISA, while ETA ,ETB and collagen levels were determined by Western blot. ANG II increased ET-1 peptide levels in a time-dependent manner reaching significance when incubated for 24 hours. NAD(P)H oxidase inhibitor, apocynin, as well as the superoxide scanverger, tempol, significantly reduced ANG Il-induced ET-1 peptide levels while over-expression of SOD1 (endogenous antioxidant enzyme) significantly decreased ANG Il-induced collagen I expression, therefore implicating reactive oxygen species in the mediation of ET-1. ANG II increased ETA receptor protein as well as collagen in a similar fashion, reaching significance after 4, 6, and 24 hours treatment. ANG II induced collagen was reduced while in the presence of the ETA receptor antagonist suggesting the role of the ETa receptor in the regulation of the extracellular matrix. ANG II treatment also increased ETB receptor protein levels in a time-dependent manner. ANG II treatment in the presence of the ETB receptor antagonist significantly increased ET-1 peptide levels. On another hand, the ETB receptor agonist, Sarafotoxin 6C, significantly decreased ET-1 peptide levels. These data implicate the role of the ETb receptor in the clearance of the ET-1 peptide. Conclusion: ANG II-induced increases of ET-1 peptide appears to be mediated by reactive oxygen species derived from NAD(P)H oxidase. Both the ETA and ETB receptors are expressed in adventitial fibroblasts. The ETA receptor subtype mediates collagen I expression, while the ETB receptor may play a protective role through increasing the clearance of the ET- 1 peptide.

The capillary supply of human skeletal muscle in health and disease

BACKGROUND: Capillaries function to provide a surface area for nutrient and waste exchange with cells. The capillary supply of skeletal muscle is highly organized, and therefore, represents an excellent choice to study factors regulating diffusion. Muscle is comprised of three specific fibre types, each with specific contractile and metabolic characteristics, which influence the capillary supply of a given muscle; in addition, both environmental and genetic factors influence the capillary supply, including aging, physical training, and various disease processes. OBJECTIVE: The present study was undertaken to develop and assess the functionality of a data base, from which virtual experiments can be conducted on the capillary supply of human muscle, and the adaptations of the capillary bed in muscle to various perturbations. METHODS: To create the database, an extensive search of the literature was conducted using various search engines, and the three key words - "capillary, muscle, and human". This search yielded 169 papers from which the data for the 46 variables on the capillary supply and fibre characteristics of muscle were extracted for inclusion in the database. A series of statistical analyses (ANOVA) were done on the capillary database to examine differences in skeletal muscle capillarization and fibre characteristics between young and old individuals, between healthy and diseased individuals, and between untrained, endurance trained, endurance welltrained, and resistance trained individuals, using SAS. RESULTS: There was a significantly higher capillarization in the young compared to the old individuals, in the healthy compared to the diseased individuals, and in the endurance-trained and endurance well-trained compared to the untrained individuals. CONCLUSIONS: The results of this study support the conclusion that the capillary supply of skeletal muscle is closely regulated by factors aimed at optimizing oxygen and nutrient supply and/or waste removal in response to changes in muscle mass and/or metabolic activity.

The relationship between stem-form, stand-closure and site -conditions : the influence of environmental conditions on tree allometry and forest structure in west-central Alberta

Changes in the configuration of a tree stern result insignificant differences in its total volume and in the proportion of that volume that is merchantable timber. Tree allometry, as represented by stem-fo~, is the result of the vertical force of gravity and the horizontal force of wind. The effect of wind force is demonstrated in the relationship between stem-form, standclosure and site-conditions. An increase in wind force on the individual tree due to a decrease in stand density should produce a more tapered tree. The density of the stand is determined by the conditions that the trees are growing under. The ability of the tree to respond to increased wind force may also be a function of these conditions . This stem-form/stand-closure/site-conditions relationship was examined using a pre-existing database from westcentral Alberta. This database consisted of environmental, vegetation, soils and timber data covering a wide range of sites. There were 653 sample trees with 82 variables that formed the basis of the analysis. There were eight tree species consisting of Pinus contorta, Picea mariana, Picea engelmannii x glauca, Abies lasiocarpa, Larix laricina, Populus tremuloides, Betula papyrifera and Populus balsamifera plus a comprehensive all-species data set. As the actual conformation of the stern is very individual, stem-fo~was represented by the diameter at breast height to total height r~tio. The four stand-closure variables, crown closure, total basal area, total volume and total number of stems were reduced to total basal area and total number of stems utilizing a bivariate correlation matrix by species. Site-conditions were subdivided into macro, meso and micro variables and reduced in number 3 using cross-tabulations, bivariate correlation and principal components analysis as screening tools. The stem-fo~/stand-closure relationship was examined using bivariate correlation coefficients for stem-fo~ with total number of stems and stem-fo~ with total basal area. The stem-fo~/site-conditions and the stand-closure/site- conditions relationships were examined using multiple correlation coefficients. The stem-form/stand-closure/site-conditions relationship was examined using multiple correlation coefficients in separate analyses for both total number of stems and total basal area. An increase in stand-closure produced a decrease in stem-form for both total number of stems and total basal area for most species. There was a significant relationship between stem-form and site-conditions and between stand-closure and site-conditions for both total number of stems and total basal area for most species. There was a significant relationship between the stemform and site-conditions, including the stand-closure, for most species; total number of stems was involved independently of the site-conditions in the prediction of stem-form and total basal area was not. Larix laricina and Betula papyrifera were the exceptions to the trends observed with most species. The influence of both stand-closure (total number of stems in particular) and site-conditions (elevation in particular) suggest that forest management practices should include these- ecological parameters in determining appropriate restocking levels.