982 resultados para Biochemical characterization of various male morphotypes
Resumo:
The goal of this study was to investigate the properties of human acid (alpha)-glucosidase with respect to: (i) the molecular heterogeneity of the enzyme and (ii) the synthesis, post-translational modification, and transport of acid (alpha)-glucosidase in human fibroblasts.^ The initial phase of these investigations involved the purification of acid (alpha)-glucosidase from the human liver. Human hepatic acid (alpha)-glucosidase was characterized by isoelectric focusing and native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Four distinct charge forms of hepatic acid (alpha)-glucosidase were separated by chromatofocusing and characterized individually. Charge heterogeneity was demonstrated to result from differences in the polypeptide components of each charge form.^ The second aspect of this research focused on the biosynthesis and the intracellular processing and transport of acid (alpha)-glucosidase in human fibroblasts. These experiments were accomplished by immune precipitation of the biosynthetic intermediates of acid (alpha)-glucosidase from radioactively labeled fibroblasts with polyclonal and monoclonal antibodies raised against human hepatic acid (alpha)-glucosidase. The immune precipitated biosynthetic forms of acid (alpha)-glucosidase were analyzed by SDS-PAGE and autoradiography. The pulse-chase experiments demonstrated the existence of several transient, high molecular weight precursors of acid (alpha)-glucosidase. These precursors were demonstrated to be intermediates of acid (alpha)-glucosidase at different stages of transport and processing in the Golgi apparatus. Other experiments were performed to examine the role of co-translational glycosylation of acid (alpha)-glucosidase in the transport and processing of precursors of this enzyme.^ A specific immunological assay for detecting acid (alpha)-glucosidase was developed using the monoclonal antibodies described above. This method was modified to increase the sensitivity of the assay by utilization of the biotin-avidin amplification system. This method was demonstrated to be more sensitive for detecting human acid (alpha)-glucosidase than the currently used biochemical assay for acid (alpha)-glucosidase activity. It was also demonstrated that the biotin-avidin immunoassay could discriminate between normal and acid (alpha)-glucosidase deficient fibroblasts, thus providing an alternative approach to detecting this inborn error in metabolism. (Abstract shortened with permission of author.) ^
Resumo:
In many organisms, polarity of the oocyte is established post-transcriptionally via subcellular RNA localization. Many RNAs are localized during oogenesis in Xenopus laevis, including Xlsirts ( Xenopus laevis short interspersed repeat transcripts) [Kloc, 1993]. Xlsirts constitute a large family defined by highly homologous repeat units 79–81 nucleotides in length. Endogenous Xlsirt RNAs use the METRO (Message Transport Organizer) pathway of localization, where RNAs are transported from the nucleus to the mitochondrial cloud in stage I oocytes. Secondly, RNAs anchor at the vegetal pole in stage II oocytes. Exogenous Xlsirt RNAs can also utilize the Late pathway of localization, which involves localization to the vegetal cortex during stage III of oogenesis and results in RNAs anchored in the cortex of the entire vegetal hemisphere. ^ The Xlsirts localization signal is contained within the repeat region. This study was designed to test the hypothesis that there are cis -acting localization elements in Xlsirts, and that higher order structure plays a role. Results of experiments on Xlsirt P11, a 1700 basepair (bp) family member, led to the conclusion that a 137-bp fragment of the repetitive region is necessary and sufficient for METRO and Late pathway localization. This analysis definitively demonstrates that the Xlsirt localization signal for the METRO and Late pathways reside within the repetitive region and not within the flanking regions. Analysis of Xlsirt linker scanning mutations revealed two METRO-pathway specific subelements, and one Late-pathway specific subelement. Functional, computer, and biochemical evidence relates the higher order structure of this element to its ability to function as a localization element. ^ Xlsirt 137 is 99% identical to the Xlsirt consensus sequence identified in this study, suggesting that it is the localization element for all localized Xlsirt family members. The repeat unit was reframed based on function, rather than arbitrarily based on sequence. This work supports the hypothesis presented in 1981 by George Spohr, who originally isolated the Xlsirts, which stated that the highly conserved repetitive elements must be constrained from variability due to some unknown function of the repeats themselves. These studies shed light on the mechanism of RNA localization, linking structure and function. ^
Resumo:
CYP4F subfamily comprises a group of enzymes that metabolize LTB4 to biologically less active metabolites. These inactive hydroxy products are incapable of chemotaxis and recruitment of inflammatory cells. This has led to a hypothesis that CYP4Fs may modulate inflammatory conditions serving as a signal of resolution. ^ We investigated the regulation of rat CYP4F gene expression under various inflammatory prompts including a bacterial lipopolysaccharide (LPS) treated model system, controlled traumatic brain injury (TBI) model as well as using direct cytokine challenges. CYP4Fs showed an isoform specific response to LPS. The pro-inflammatory cytokines IL-1β, IL-6 and TNF-α produced an overall inductive CYP4F response whereas IL-10, an anti-inflammatory cytokine, suppressed CYP4F gene expression in primary hepatocytes. The molecular mechanism behind IL-6 mediated CYP4F induction was partially STAT3 dependent. ^ An alternate avenue of triggering the inflammatory cascade is TBI, which is known to cause several secondary effects leading to multiorgan dysfunction syndrome. The results from this study elicited that trauma to the brain can produce acute inflammatory changes in organs distant from the injury site. Local production of LTB4 after CNS injury caused mobilization of inflammatory cells such as neutrophils to the lung. In the resolution phase, CYP4F expression increased with time along with the associated activity causing a decline in LTB4 concentration. This marked a significant reduction in neutrophil recruitment to the lung which led to subsequent recovery and repair. In addition, we showed that CYP4Fs are localized primarily in pulmonary endothelium. We speculate that the temporally regulated LTB4 clearance in the endothelium may be a novel target for treatment of pulmonary inflammation following injury. ^ In humans, several CYP4F isoforms have been identified and shown to metabolize LTB4 and other endogenous eicosanoids. However, the specific activity of the recently cloned human CYP4F11 is unknown. In the final part of this thesis, CYP4F11 protein was expressed in yeast in parallel to CYP4F3A. To our surprise, CYP4F11 displayed a different substrate profile than CYP4F3A. CYP4F3A metabolized eicosanoids while CYP4F11 was a better catalyst for therapeutic drugs. Thus, besides their endogenous function in clearing inflammation, CYP4Fs also may play a part in drug metabolism. ^
Resumo:
Interleukin-2 (IL-2) is a major T cell growth factor and plays an essential role in the development of normal immune responses. The Janus kinases (Jaks) and Signal transducers and activators of transcription (Stats) are critical for transducing signals from the IL-2 receptors (IL2Rs) to the nucleus to control cell growth and differentiation. In recent years there has been increasing evidence to indicate that the IL-2 activated Jak3/Stat5 pathway provides a new molecular target for immune suppression. Thus, understanding the regulation of this effector cascade has important therapeutic potential.^ One objective of this work was to identify and define the role and molecular mechanism of novel phosphorylation sites in Jak3. Using functional proteomics, three novel Jak3 phosphorylation sites, Y904, Y939 and S574 were identified. Phosphospecific antibodies confirmed that phosphorylation of Y904 and Y939 were mediated by IL-2 and other IL-2 family cytokines in distinct cell types. Biochemical analysis demonstrated that phosphorylation of both Y904 and Y939 positively regulated Jak3 enzymatic activity, while phosphorylation of S574 did not affect Jak3 in vitro kinase activity. However, a gain-of-function mutation of S574 in Jak3 abrogated IL-2 mediated Stat5 activation, suggesting that phosphorylation of this residue might serve a negative role to attenuate IL-2 signaling. Furthermore, mechanistic analysis suggested that phosphorylation of Y904 in Jak3 affects the KmATP of Jak3, while phosphorylation of Y939 in Jak3 was required to bind one of its substrates, Stat5.^ The second objective was to determine the role of serine/threonine phosphatases in the regulation of the IL2R complex. Activation of Jak3 and Stat5 by IL-2 is a transient event mediated by phosphorylation. Using a specific PP1/PP2A inhibitor, we observed that inhibition of PP1/PP2A negatively regulated the IL-2 activated Jak3/Stat5 signaling pathway in a human NK cell line (YT) and primary human T cells. More importantly, coimmunoprecipitation assays indicated that inhibition of PP1/PP2A blocked the formation of an active IL2R complex. Pretreatment of cells with the inhibitor also reduced the electrophoretic mobility of the IL2Rβ and IL2Rγ subunits in YT cells, suggesting that inhibition of PP1/PP2A directly or indirectly regulates undefined serine/threonine kinases which phosphorylate these proteins. Based on these observations, a model has emerged that serine/threonine phosphorylation of the IL2Rβ and IL2Rγ subunits causes a conformational change of these proteins, which disrupts IL2R dimerization and association of Jak3 and Stat5 to these receptors.^
Resumo:
Channelrhodopsins are phototaxis receptors in the plasma membranes of motile unicellular algae. They function as light-gated cation channels and this channel activity has been exploited to trigger action potentials in neurons with light to control neural circuits (“optogenetics"). Four channelrhodopsins were identified in two algal species, Chlamydomonas reinhardtii and Volvox carteri, with known genome sequences; each species contains 2 channelrhodopsins, one absorbing at longer wavelengths and one at shorter wavelengths, named CrChR1 and CrChR2, respectively. Our goals are to expand knowledge of channelrhodopsin mechanisms and also to identify new channelrhodopsins from various algal species with improved properties for optogenetic use. For these aims we are targeting algae from extreme environments to establish the natural diversity of their properties. We cloned a new channelrhodopsin from the psychrophilic (cold-loving) alga, Chlamydomonas augustae, with degenerate primers based on the 4 known homologs. The new protein is 48% and 52% identical to CrChR1 and CrChR2, respectively. We expressed the channelrhodopsin in HEK293 cells and measured light-induced currents to assess their kinetics and action spectrum. Based on the primary structure, kinetics of light-induced photocurrents in HEK293 cells, and action spectrum maximum of 520 nm near that of the two previously found CrChR1, we named the new channelrhodopsin CaChR1. The properties of robust channel activity at physiological pH, fast on-and-off kinetics, and greatly red-shifted action spectrum maximum from that of CrChR2, make CaChR1 advantageous as an optogenetic tool. To know this new channelrhodopsin better, we expressed His-tagged CaChR1 in Pichia pastoris and the yield is about 6 mg/L. The purified His-tagged CaChR1 exhibited an absorption spectrum identical to the action spectrum of CaChR1-generated photocurrents. The future work will be measurement of the photocycles of CaChR1 by flash photolysis, crystallization of CaChR1 for the structure and mutagenesis of CaChR1 to find the critical amino acids accounting for red-shifted spectra, slow inactivation and rapid on-and-off kinetics. Seven new channelrhodopsins including CaChR1 from different algal species have been cloned in our lab at this time, bringing the total known to 13. The work of cloning of these new channelrhodopsins along with the expression of CaChR1 was published in Photochemistry and Photobiology in January 2012
Resumo:
Dental caries is the most common chronic disease worldwide. It is characterized by the demineralization of tooth enamel caused by acid produced by cariogenic dental bacteria growing on tooth surfaces, termed bacterial biofilms. Cariogenesis is a complex biological process that is influence by multiple factors and is not attributed to a sole causative agent. Instead, caries is associated with multispecies microbial biofilm communities composed of some bacterial species that directly influence the development of a caries lesion and other species that are seemingly benign but must contribute to the community in an uncharacterized way. Clinical analysis of dental caries and its microbial populations is challenging due to many factors including low sensitivity of clinical measurement tools, variability in saliva chemistry, and variation in the microbiota. Our laboratory has developed an in vitro anaerobic biofilm model for dental carries to facilitate both clinical and basic research-based analyses of the multispecies dynamics and individual factors that contribute to cariogenicity. The rational for development of this system was to improve upon the current models that lack key elements. This model places an emphasis on physiological relevance and ease of maintenance and reproducibility. The uniqueness of the model is based on integrating four critical elements: 1) a biofilm community composed of four distinct and representative species typically associated with dental caries, 2) a semi-defined synthetic growth medium designed to mimic saliva, 3) physiologically relevant biofilm growth substrates, and 4) a novel biofilm reactor device designed to facilitate the maintenance and analysis. Specifically, human tooth sections or hydroxyapatite discs embedded into poly(methyl methacrylate) (PMMA) discs are incubated for an initial 24 hr in a static inverted removable substrate (SIRS) biofilm reactor at 37°C under anaerobic conditions in artificial saliva (CAMM) without sucrose in the presence of 1 X 106 cells/ml of each Actinomyces odontolyticus, Fusobacterium nucleatum, Streptococcus mutans, and Veillonella dispar. During days 2 and 3 the samples are maintained continually in CAMM with various exposures to 0.2% sucrose; all of the discs are transferred into fresh medium every 24 hr. To validate that this model is an appropriate in vitro representation of a caries-associated multispecies biofilm, research aims were designed to test the following overarching hypothesis: an in vitro anaerobic biofilm composed of four species (S. mutans, V. dispar, A. odontolyticus, and F. nucleatum) will form a stable biofilm with a community profile that changes in response to environmental conditions and exhibits a cariogenic potential. For these experiments the biofilms as described above were exposed on days 2 and 3 to either CAMM lacking sucrose (no sucrose), CAMM with 0.2% sucrose (constant sucrose), or were transferred twice a day for 1 hr each time into 0.2% sucrose (intermittent sucrose). Four types of analysis were performed: 1) fluorescence microscopy of biofilms stained with Syto 9 and hexidium idodine to determine the biofilm architecture, 2) quantitative PCR (qPCR) to determine the cell number of each species per cm2, 3) vertical scanning interferometry (VSI) to determine the cariogenic potential of the biofilms, and 4) tomographic pH imaging using radiometric fluorescence microscopy after exposure to pH sensitive nanoparticles to measure the micro-environmental pH. The qualitative and quantitative results reveal the expected dynamics of the community profile when exposed to different sucrose conditions and the cariogenic potential of this in vitro four-species anaerobic biofilm model, thus confirming its usefulness for future analysis of primary and secondary dental caries.
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Regulation of cytoplasmic deadenylation, the first step in mRNA turnover, has direct impact on the fate of gene expression. AU-rich elements (AREs) found in the 3′ untranslated regions of many labile mRNAs are the most common RNA-destabilizing elements known in mammalian cells. Based on their sequence features and functional properties, AREs can be divided into three classes. Class I or class III ARE directs synchronous deadenylation, whereas class II ARE directs asynchronous deadenylation with the formation of poly(A)-intermediates. Through systematic mutagenesis study, we found that a cluster of five or six copies of AUUUA motifs forming various degrees of reiteration is the key feature dictating the choice between asynchronous versus synchronous deadenylation. A 20–30 nt AU-rich sequence immediately 5 ′ to this cluster of AUUUA motifs can greatly enhance its destabilizing ability and is an integral part of the AREs. These two features are the defining characteristics of class II AREs. ^ To better understand the decay mechanism of AREs, current methods have several limitations. Taking the advantage of tetracycline-regulated promoter, we developed a new transcriptional pulse strategy, Tet-system. By controlling the time and the amount of Tet addition, a pulse of RNA could be generated. Using this new system, we showed that AREs function in both growth- and density-arrested cells. The new strategy offers for the first time an opportunity to investigate control of mRNA deadenylation and decay kinetics in mammalian cells that exhibit physiologically relevant conditions. ^ As a member of heterogeneous nuclear RNA-binding protein, hnRNP D 0/AUF1 displays specific affinities for ARE sequences in vitro . But its in vivo function in ARE-mediated mRNA decay is unclear. AUF1/hnRNP D0 is composed of at least four isoforms derived by alternative RNA splicing. Each isoform exhibits different affinity for ARE sequence in vitro. Here, we examined in vivo effect of AUF1s/hnRNP D0s on degradation of ARE-containing mRNA. Our results showed that all four isoforms exhibit various RNA stabilizing effects in NIH3T3 cells, which are positively correlated with their binding affinities for ARE sequences. Further experiments indicated that AUF1/hnRNP D0 has a general role in modulating the stability of cytoplasmic mRNAs in mammalian cells. ^
Resumo:
Molecular events involved in specification of early hematopoietic system are not well known. In Xenopus, a paired-box homeodomain family (Mix.1–4) has been implicated in this process. Although Mix-like homeobox genes have been isolated from zebrafish (bon), chicken (CMIX) and mice (MmI/MIXL1), isolation of a human Mix-like gene has remained elusive. ^ We have recently isolated and characterized a novel human Mix-like homeobox gene with a predicted open reading frame of 232 amino acids designated the Mix.1 homeobox (Xenopus laevis)-like gene (MIXL). The overall identity of this novel protein to CMIX and MmI/MIXL1 is 41% and 69%, respectively. However, the identity in the homeodomain is 66% to that of Xenopus Mix.1, 79% to that of CMIX, and 94% to that of MmI/MIXL1. In normal hematopoiesis, MIXL expression appears to be restricted immature B and T lymphoid cells. Several acute leukemic cell lines of B, T and myeloid lineages express MIXL suggesting a survival/block in differentiation advantage. Furthermore, Xenopus animal cap assay revealed that MIXL could induce expression of the α-globin gene, suggesting a functional conservation of the homeodomain. ^ Biochemical analysis revealed that MIXL proteins are phosphorylated at multiple sites. Immunoprecipitation and immunoblotting confirmed that MIXL is tyrosine phosphorylated. Mutational analysis determined that Tyr20 appears to be the site for phosphorylation. However, deletion analysis preliminarily showed that the proline-rich domain appears not to be necessary for tyrosine phosphorylation. The novel finding will help us make a deeper understanding of the regulation on homeodomain proteins by rarely reported tyrosine phosphorylation. ^ Taken together, isolation of the MIXL gene is the first step toward understanding novel regulatory circuits in early hematopoietic differentiation and malignant transformation. ^
Resumo:
An automated panoramic irradiator with a 3 Ci 241Am-Be neutron source is installed in a bunker-type large room at the Universidad Politécnica de Madrid (UPM). It was recently modified and a neutron spectrometry campaign was organized to characterize the neutron fields in different measurement points along the irradiation bench. Four research groups working with different Bonner Sphere Spectrometers (BSS) and using different spectral unfolding codes took part to this exercise. INFN-LNF used a BSS formed by 9 spheres plus bare detector, with cylindrical, almost point like, 6LiI(Eu) scintillator (4 mm x 4 mm, from Ludlum); UAZ-UPM employed a similar system but with only 6 spheres plus bare detector; UAB worked with a 3He filled proportional counter at 8kPa filling pressure, cylindrical 9 mm x 10 mm (05NH1 from Eurisys) with 11 spheres configuration; and CIEMAT used 12 spheres with an spherical 3He SP9 counter (Centronic Ltd., UK) with very high sensitivity due to the large diameter (3.2 cm) and the filling pressure of the order of 228 kPa. Each group applied a different spectral unfolding method: INFN and UAB worked with FRUIT ver. 3.0 with their own response matrixes; UAZ-UPM used the BUNKIUT unfolding code with the response matrix UTA4 and CIEMAT employed the GRAVEL-MAXED-IQU package with their own response matrix. The paper shows the main results obtained in terms of neutron spectra at fixed distances from the source as well as total neutron fluence rate and ambient dose equivalent rate H*(10) determined from the spectra. The latter are compared with the readings of a common active survey-meter (LB 6411). The small differences in the results of the various groups are discussed.
Resumo:
DNA binding with One Finger (DOF) transcription factors are involved in multiple aspects of plant growth and development but their precise roles in abiotic stress tolerance are largely unknown. Here we report a group of five tomato DOF genes, homologous to Arabidopsis Cycling DOF Factors (CDFs), that function as transcriptional regulators involved in responses to drought and salt stress and flowering-time control in a gene-specific manner. SlCDF1?5 are nuclear proteins that display specific binding with different affinities to canonical DNA target sequences and present diverse transcriptional activation capacities in vivo. SlCDF1?5 genes exhibited distinct diurnal expression patterns and were differentially induced in response to osmotic, salt, heat, and low-temperature stresses. Arabidopsis plants overexpressing SlCDF1 or SlCDF3 showed increased drought and salt tolerance. In addition, the expression of various stress-responsive genes, such as COR15, RD29A, and RD10, were differentially activated in the overexpressing lines. Interestingly, overexpression in Arabidopsis of SlCDF3 but not SlCDF1 promotes late flowering through modulation of the expression of flowering control genes such as CO and FT. Overall, our data connect SlCDFs to undescribed functions related to abiotic stress tolerance and flowering time through the regulation of specific target genes and an increase in particular metabolites
Resumo:
El tomate (Solanum lycopersicum L.) es considerado uno de los cultivos hortícolas de mayor importancia económica en el territorio Español. Sin embargo, su producción está seriamente afectada por condiciones ambientales adversas como, salinidad, sequía y temperaturas extremas. Para resolver los problemas que se presentan en condiciones de estrés, se han empleado una serie de técnicas culturales que disminuyen sus efectos negativos, siendo de gran interés el desarrollo de variedades tolerantes. En este sentido la obtención y análisis de plantas transgénicas, ha supuesto un avance tecnológico, que ha facilitado el estudio y la evaluación de genes seleccionados en relación con la tolerancia al estrés. Estudios recientes han mostrado que el uso de genes reguladores como factores de transcripción (FTs) es una gran herramienta para obtener nuevas variedades de tomate con mayor tolerancia a estreses abióticos. Las proteínas DOF (DNA binding with One Finger) son una familia de FTs específica de plantas (Yangisawa, 2002), que están involucrados en procesos fisiológicos exclusivos de plantas como: asimilación del nitrógeno y fijación del carbono fotosintético, germinación de semilla, metabolismo secundario y respuesta al fotoperiodo pero su preciso rol en la tolerancia a estrés abiótico se desconoce en gran parte. El trabajo descrito en esta tesis tiene como objetivo estudiar genes reguladores tipo DOF para incrementar la tolerancia a estrés abiotico tanto en especies modelo como en tomate. En el primer capítulo de esta tesis se muestra la caracterización funcional del gen CDF3 de Arabidopsis, así como su papel en la respuesta a estrés abiótico y otros procesos del desarrollo. La expresión del gen AtCDF3 es altamente inducido por sequía, temperaturas extremas, salinidad y tratamientos con ácido abscísico (ABA). La línea de inserción T-DNA cdf3-1 es más sensible al estrés por sequía y bajas temperaturas, mientras que líneas transgénicas de Arabidopsis 35S::AtCDF3 aumentan la tolerancia al estrés por sequía, osmótico y bajas temperaturas en comparación con plantas wild-type (WT). Además, estas plantas presentan un incremento en la tasa fotosintética y apertura estomática. El gen AtCDF3 se localiza en el núcleo y que muestran una unión específica al ADN con diferente afinidad a secuencias diana y presentan diversas capacidades de activación transcripcional en ensayos de protoplastos de Arabidopsis. El dominio C-terminal de AtCDF3 es esencial para esta localización y su capacidad activación, la delección de este dominio reduce la tolerancia a sequía en plantas transgénicas 35S::AtCDF3. Análisis por microarray revelan que el AtCDF3 regula un set de genes involucrados en el metabolismo del carbono y nitrógeno. Nuestros resultados demuestran que el gen AtCDF3 juega un doble papel en la regulación de la respuesta a estrés por sequía y bajas temperaturas y en el control del tiempo de floración. En el segundo capítulo de este trabajo se lleva a cabo la identificación de 34 genes Dof en tomate que se pueden clasificar en base a homología de secuencia en cuatro grupos A-D, similares a los descritos en Arabidopsis. Dentro del grupo D se han identificado cinco genes DOF que presentan características similares a los Cycling Dof Factors (CDFs) de Arabidopsis. Estos genes son considerados ortólogos de Arabidopsis CDF1-5, y han sido nombrados como Solanum lycopersicum CDFs o SlCDFs. Los SlCDF1-5 son proteínas nucleares que muestran una unión específica al ADN con diferente afinidad a secuencias diana y presentan diversas capacidades de activación transcripcional in vivo. Análisis de expresión de los genes SlCDF1-5 muestran diferentes patrones de expresión durante el día y son inducidos de forma diferente en respuesta a estrés osmótico, salino, y de altas y bajas temperaturas. Plantas de Arabidopsis que sobre-expresan SlCDF1 y SlCDF3 muestran un incremento de la tolerancia a la sequía y salinidad. Además, de la expresión de varios genes de respuesta estrés como AtCOR15, AtRD29A y AtERD10, son expresados de forma diferente en estas líneas. La sobre-expresión de SlCDF3 en Arabidopsis promueve un retardo en el tiempo de floración a través de la modulación de la expresión de genes que controlan la floración como CONSTANS (CO) y FLOWERING LOCUS T (FT). En general, nuestros datos demuestran que los SlCDFs están asociados a funciones aun no descritas, relacionadas con la tolerancia a estrés abiótico y el control del tiempo de floración a través de la regulación de genes específicos y a un aumento de metabolitos particulares. ABSTRACT Tomato (Solanum lycopersicum L.) is one of the horticultural crops of major economic importance in the Spanish territory. However, its production is being affected by adverse environmental conditions such as salinity, drought and extreme temperatures. To resolve the problems triggered by stress conditions, a number of agricultural techniques that reduce the negative effects of stress are being frequently applied. However, the development of stress tolerant varieties is of a great interest. In this direction, the technological progress in obtaining and analysis of transgenic plants facilitated the study and evaluation of selected genes in relation to stress tolerance. Recent studies have shown that a use of regulatory genes such as transcription factors (TFs) is a great tool to obtain new tomato varieties with greater tolerance to abiotic stresses. The DOF (DNA binding with One Finger) proteins form a family of plant-specific TFs (Yangisawa, 2002) that are involved in the regulation of particular plant processes such as nitrogen assimilation, photosynthetic carbon fixation, seed germination, secondary metabolism and flowering time bur their precise roles in abiotic stress tolerance are largely unknown. The work described in this thesis aims at the study of the DOF type regulatory genes to increase tolerance to abiotic stress in both model species and the tomato. In the first chapter of this thesis, we present molecular characterization of the Arabidopsis CDF3 gene as well as its role in the response to abiotic stress and in other developmental processes. AtCDF3 is highly induced by drought, extreme temperatures, salt and abscisic acid (ABA) treatments. The cdf3-1 T-DNA insertion mutant was more sensitive to drought and low temperature stresses, whereas the AtCDF3 overexpression enhanced the tolerance of transgenic plants to drought, cold and osmotic stress comparing to the wild-type (WT) plants. In addition, these plants exhibit increased photosynthesis rates and stomatal aperture. AtCDF3 is localized in the nuclear region, displays specific binding to the canonical DNA target sequences and has a transcriptional activation activity in Arabidopsis protoplast assays. In addition, the C-terminal domain of AtCDF3 is essential for its localization and activation capabilities and the deletion of this domain significantly reduces the tolerance to drought in transgenic 35S::AtCDF3 overexpressing plants. Microarray analysis revealed that AtCDF3 regulated a set of genes involved in nitrogen and carbon metabolism. Our results demonstrate that AtCDF3 plays dual roles in regulating plant responses to drought and low temperature stress and in control of flowering time in vegetative tissues. In the second chapter this work, we carried out to identification of 34 tomato DOF genes that were classified by sequence similarity into four groups A-D, similar to the situation in Arabidopsis. In the D group we have identified five DOF genes that show similar characteristics to the Cycling Dof Factors (CDFs) of Arabidopsis. These genes were considered orthologous to the Arabidopsis CDF1 - 5 and were named Solanum lycopersicum CDFs or SlCDFs. SlCDF1-5 are nuclear proteins that display specific binding to canonical DNA target sequences and have transcriptional activation capacities in vivo. Expression analysis of SlCDF1-5 genes showed distinct diurnal expression patterns and were differentially induced in response to osmotic, salt and low and high temperature stresses. Arabidopsis plants overexpressing SlCDF1 and SlCDF3 showed increased drought and salt tolerance. In addition, various stress-responsive genes, such as AtCOR15, AtRD29A and AtERD10, were expressed differently in these lines. The overexpression of SlCDF3 in Arabidopsis also results in the late flowering phenotype through the modulation of the expression of flowering control genes such CONSTANS (CO) and FLOWERING LOCUS T (FT). Overall, our data connet SlCDFs to undescribed functions related to abiotic stress tolerance and flowering time through the regulation of specific target genes and an increase in particular metabolites.
Resumo:
Las cascadas de señalización mediadas por proteína quinasas activadas por mitógeno (MAP quinasas) son capaces de integrar y transducir señales ambientales en respuestas celulares. Entre estas señales se encuentran los PAMPs/MAMPs (Pathogen/Microbe-Associated Molecular Patterns), que son moléculas de patógenos o microorganismos, o los DAMPs (Damaged-Associated Molecular Patterns), que son moléculas derivadas de las plantas producidas en respuesta a daño celular. Tras el reconocimiento de los PAMPs/DAMPs por receptores de membrana denominados PRRs (Pattern Recognition Receptors), como los receptores con dominio quinasa (RLKs) o los receptores sin dominio quinasa (RLPs), se activan respuestas moleculares, incluidas cascadas de MAP quinasas, que regulan la puesta en marcha de la inmunidad activada por PAMPs (PTI). Esta Tesis describe la caracterización funcional de la MAP quinasa quinasa quinasa (MAP3K) YODA (YDA), que actúa como un regulador clave de la PTI en Arabidopsis. Se ha descrito previamente que YDA controla varios procesos de desarrollo, como la regulación del patrón estomático, la elongación del zigoto y la arquitectura floral. Hemos caracterizado un alelo mutante hipomórfico de YDA (elk2 o yda11) que presenta una elevada susceptibilidad a patógenos biótrofos y necrótrofos. Notablemente, plantas que expresan una forma constitutivamente activa de YDA (CA-YDA), con una deleción en el dominio N-terminal, presentan una resistencia de amplio espectro frente a diferentes tipos de patógenos, incluyendo hongos, oomicetos y bacterias, lo que indica que YDA juega un papel importante en la regulación de la resistencia de las plantas a patógenos. Nuestros datos indican que esta función es independiente de las respuestas inmunes mediadas por los receptores previamente caracterizados FLS2 y CERK1, que reconocen los PAMPs flg22 y quitina, respectivamente, y que están implicados en la resistencia de Arabidopsis frente a bacterias y hongos. Hemos demostrado que YDA controla la resistencia frente al hongo necrótrofo Plectosphaerella cucumerina y el patrón estomático mediante su interacción genética con la RLK ERECTA (ER), un PRR implicado en la regulación de estos procesos. Por el contrario, la interacción genética entre ER y YDA en la regulación de otros procesos de desarrollo es aditiva en lugar de epistática. Análisis genéticos indicaron que MPK3, una MAP quinasa que funciona aguas abajo de YDA en el desarrollo estomático, es un componente de la ruta de señalización mediada por YDA para la resistencia frente a P. cucumerina, lo que sugiere que el desarrollo de las plantas y la PTI comparten el módulo de transducción de MAP quinasas asociado a YDA. Nuestros experimentos han revelado que la resistencia mediada por YDA es independiente de las rutas de señalización reguladas por las hormonas de defensa ácido salicílico, ácido jasmónico, ácido abscísico o etileno, y también es independiente de la ruta de metabolitos secundarios derivados del triptófano, que están implicados en inmunidad vegetal. Además, hemos demostrado que respuestas asociadas a PTI, como el aumento en la concentración de calcio citoplásmico, la producción de especies reactivas de oxígeno, la fosforilación de MAP quinasas y la expresión de genes de defensa, no están afectadas en el mutante yda11. La expresión constitutiva de la proteína CA-YDA en plantas de Arabidopsis no provoca un aumento de las respuestas PTI, lo que sugiere la existencia de mecanismos de resistencia adicionales regulados por YDA que son diferentes de los regulados por FLS2 y CERK1. En línea con estos resultados, nuestros datos transcriptómicos revelan una sobre-representación en plantas CA-YDA de genes de defensa que codifican, por ejemplo, péptidos antimicrobianos o reguladores de muerte celular, o proteínas implicadas en la biogénesis de la pared celular, lo que sugiere una conexión potencial entre la composición e integridad de la pared celular y la resistencia de amplio espectro mediada por YDA. Además, análisis de fosfoproteómica indican la fosforilación diferencial de proteínas relacionadas con la pared celular en plantas CA-YDA en comparación con plantas silvestres. El posible papel de la ruta ER-YDA en la regulación de la integridad de la pared celular está apoyado por análisis bioquímicos y glicómicos de las paredes celulares de plantas er, yda11 y CA-YDA, que revelaron cambios significativos en la composición de la pared celular de estos genotipos en comparación con la de plantas silvestres. En resumen, nuestros datos indican que ER y YDA forman parte de una nueva ruta de inmunidad que regula la integridad de la pared celular y respuestas defensivas, confiriendo una resistencia de amplio espectro frente a patógenos. ABSTRACT Plant mitogen-activated protein kinase (MAPK) cascades transduce environmental signals and developmental cues into cellular responses. Among these signals are the pathogen- or microbe-associated molecular patterns (PAMPs or MAMPs) and the damage-associated molecular patterns (DAMPs). These PAMPs/DAMPs, upon recognition by plant pattern recognition receptors (PRRs), such as Receptor-Like Kinases (RLKs) and Receptor-Like Proteins (RLPs), activate molecular responses, including MAPK cascades, which regulate the onset of PAMP-triggered immunity (PTI). This Thesis describes the functional characterization of the MAPK kinase kinase (MAP3K) YODA (YDA) as a key regulator of Arabidopsis PTI. YDA has been previously described to control several developmental processes, such as stomatal patterning, zygote elongation and inflorescence architecture. We characterized a hypomorphic, non-embryo lethal mutant allele of YDA (elk2 or yda11) that was found to be highly susceptible to biotrophic and necrotrophic pathogens. Remarkably, plants expressing a constitutive active form of YDA (CA-YDA), with a deletion in the N-terminal domain, showed broad-spectrum resistance to different types of pathogens, including fungi, oomycetes and bacteria, indicating that YDA plays a relevant function in plant resistance to pathogens. Our data indicated that this function is independent of the immune responses regulated by the well characterized FLS2 and CERK1 RLKs, which are the PRRs recognizing flg22 and chitin PAMPs, respectively, and are required for Arabidopsis resistance to bacteria and fungi. We demonstrate that YDA controls resistance to the necrotrophic fungus Plectosphaerella cucumerina and stomatal patterning by genetically interacting with ERECTA (ER) RLK, a PRR involved in regulating these processes. In contrast, the genetic interaction between ER and YDA in the regulation of other ER-associated developmental processes was additive, rather than epistatic. Genetic analyses indicated that MPK3, a MAP kinase that functions downstream of YDA in stomatal development, also regulates plant resistance to P. cucumerina in a YDA-dependent manner, suggesting that the YDA-associated MAPK transduction module is shared in plant development and PTI. Our experiments revealed that YDA-mediated resistance was independent of signalling pathways regulated by defensive hormones like salicylic acid, jasmonic acid, abscisic acid or ethylene, and of the tryptophan-derived metabolites pathway, which are involved in plant immunity. In addition, we showed that PAMP-mediated PTI responses, such as the increase of cytoplasmic Ca2+ concentration, reactive oxygen species (ROS) burst, MAPK phosphorylation, and expression of defense-related genes are not impaired in the yda11 mutant. Furthermore, the expression of CA-YDA protein does not result in enhanced PTI responses, further suggesting the existence of additional mechanisms of resistance regulated by YDA that differ from those regulated by the PTI receptors FLS2 and CERK1. In line with these observations, our transcriptomic data revealed the over-representation in CA-YDA plants of defensive genes, such as those encoding antimicrobial peptides and cell death regulators, and genes encoding cell wall-related proteins, suggesting a potential link between plant cell wall composition and integrity and broad spectrum resistance mediated by YDA. In addition, phosphoproteomic data revealed an over-representation of genes encoding wall-related proteins in CA-YDA plants in comparison with wild-type plants. The putative role of the ER-YDA pathway in regulating cell wall integrity was further supported by biochemical and glycomics analyses of er, yda11 and CA-YDA cell walls, which revealed significant changes in the cell wall composition of these genotypes compared with that of wild-type plants. In summary, our data indicate that ER and YDA are components of a novel immune pathway that regulates cell wall integrity and defensive responses, which confer broad-spectrum resistance to pathogens.
Resumo:
Los sistemas micro electro mecánicos (MEMS) han demostrado ser una exitosa familia de dispositivos que pueden usarse como plataforma para el desarrollo de dispositivos con aplicaciones en óptica, comunicaciones, procesado de señal y sensorización. Los dispositivos MEMS estándar suelen estar fabricados usando tecnología de silicio. Sin embargo, el rendimiento de estos MEMS se puede mejorar si se usan otros materiales. Por ejemplo, el diamante nanocristalino (NCD) ofrece unas excelentes propiedades mecánicas, transparencia y una superficie fácil de funcionalizar. Por otro lado, el sistema de materiales (In; Ga; Al)N, los materiales IIIN, se pueden usar para producir estructuras monocristalinas con alta sensibilidad mecánica y química. Además, el AlN se puede depositar por pulverización catódica reactiva sobre varios substratos, incluyendo NCD, para formar capas policristalinas orientadas con alta respuesta piezoeléctrica. Adicionalmente, tanto el NCD como los materiales III-N muestran una gran estabilidad térmica y química, lo que los hace una elección idónea para desarrollar dispositivos para aplicaciones para alta temperatura, ambientes agresivos e incluso para aplicaciones biocompatibles. En esta tesis se han usado estos materiales para el diseño y medición de demostradores tecnológicos. Se han perseguido tres objetivos principales: _ Desarrollo de unos procesos de fabricación apropiados. _ Medición de las propiedades mecánicas de los materiales y de los factores que limitan el rendimiento de los dispositivos. _ Usar los datos medidos para desarrollar dispositivos demostradores complejos. En la primera parte de esta tesis se han estudiado varias técnicas de fabricación. La estabilidad de estos materiales impide el ataque y dificulta la producción de estructuras suspendidas. Los primeros capítulos de esta disertación se dedican al desarrollo de unos procesos de transferencia de patrones por ataque seco y a la optimización del ataque húmedo sacrificial de varios substratos propuestos. Los resultados de los procedimientos de ataque se presentan y se describe la optimización de las técnicas para la fabricación de estructuras suspendidas de NCD y materiales III-N. En un capítulo posterior se estudia el crecimiento de AlN por pulverización catódica. Como se ha calculado en esta disertación para obtener una actuación eficiente de MEMS, las capas de AlN han de ser finas, típicamente d < 200 nm, lo que supone serias dificultades para la obtención de capas orientadas con respuesta piezoeléctrica. Las condiciones de depósito se han mapeado para identificar las fronteras que proporcionan el crecimiento de material orientado desde los primeros pasos del proceso. Además, durante la optimización de los procesos de ataque se estudió un procedimiento para fabricar películas de GaN nanoporoso. Estas capas porosas pueden servir como capas sacrificiales para la fabricación de estructuras suspendidas de GaN con baja tensión residual o como capas para mejorar la funcionalización superficial de sensores químicos o biológicos. El proceso de inducción de poros se discutirá y también se presentarán experimentos de ataque y funcionalización. En segundo lugar, se han determinado las propiedades mecánicas del NCD y de los materiales III-N. Se han fabricado varias estructuras suspendidas para la medición del módulo de Young y de la tensión residual. Además, las estructuras de NCD se midieron en resonancia para calcular el rendimiento de los dispositivos en términos de frecuencia y factor de calidad. Se identificaron los factores intrínsecos y extrínsecos que limitan ambas figuras de mérito y se han desarrollado modelos para considerar estas imperfecciones en las etapas de diseño de los dispositivos. Por otra parte, los materiales III-N normalmente presentan grandes gradientes de deformación residual que causan la deformación de las estructuras al ser liberadas. Se han medido y modelado estos efectos para los tres materiales binarios del sistema para proporcionar puntos de interpolación que permitan predecir las características de las aleaciones del sistema III-N. Por último, los datos recabados se han usado para desarrollar modelos analíticos y numéricos para el diseño de varios dispositivos. Se han estudiado las propiedades de transducción y se proporcionan topologías optimizadas. En el último capítulo de esta disertación se presentan diseños optimizados de los siguientes dispositivos: _ Traviesas y voladizos de AlN=NCD con actuación piezoeléctrica aplicados a nanoconmutadores de RF para señales de alta potencia. _ Membranas circulares de AlN=NCD con actuación piezoeléctrica aplicadas a lentes sintonizables. _ Filtros ópticos Fabry-Pérot basados en cavidades aéreas y membranas de GaN actuadas electrostáticamente. En resumen, se han desarrollado unos nuevos procedimientos optimizados para la fabricación de estructuras de NCD y materiales III-N. Estas técnicas se han usado para producir estructuras que llevaron a la determinación de las principales propiedades mecánicas y de los parámetros de los dispositivos necesarios para el diseño de MEMS. Finalmente, los datos obtenidos se han usado para el diseño optimizado de varios dispositivos demostradores. ABSTRACT Micro Electro Mechanical Systems (MEMS) have proven to be a successful family of devices that can be used as a platform for the development of devices with applications in optics, communications, signal processing and sensorics. Standard MEMS devices are usually fabricated using silicon based materials. However, the performance of these MEMS can be improved if other material systems are used. For instance, nanocrystalline diamond (NCD) offers excellent mechanical properties, optical transparency and ease of surface functionalization. On the other hand, the (In; Ga; Al)N material system, the III-N materials, can be used to produce single crystal structures with high mechanical and chemical sensitivity. Also, AlN can be deposited by reactive sputtering on various substrates, including NCD, to form oriented polycrystalline layers with high piezoelectric response. In addition, both NCD and III-N materials exhibit high thermal and chemical stability, which makes these material the perfect choice for the development of devices for high temperatures, harsh environments and even biocompatible applications. In this thesis these materials have been used for the design and measurement of technological demonstrators. Three main objectives have been pursued: _ Development of suitable fabrication processes. _ Measurement of the material mechanical properties and device performance limiting factors. _ Use the gathered data to design complex demonstrator devices. In a first part of the thesis several fabrication processes have been addressed. The stability of these materials hinders the etching of the layers and hampers the production of free standing structures. The first chapters of this dissertation are devoted to the development of a dry patterning etching process and to sacrificial etching optimization of several proposed substrates. The results of the etching processes are presented and the optimization of the technique for the manufacturing of NCD and III-N free standing structures is described. In a later chapter, sputtering growth of thin AlN layers is studied. As calculated in this dissertation, for efficient MEMS piezoelectric actuation the AlN layers have to be very thin, typically d < 200 nm, which poses serious difficulties to the production of c-axis oriented material with piezoelectric response. The deposition conditions have been mapped in order to identify the boundaries that give rise to the growth of c-axis oriented material from the first deposition stages. Additionally, during the etching optimization a procedure for fabricating nanoporous GaN layers was also studied. Such porous layers can serve as a sacrificial layer for the release of low stressed GaN devices or as a functionalization enhancement layer for chemical and biological sensors. The pore induction process will be discussed and etching and functionalization trials are presented. Secondly, the mechanical properties of NCD and III-N materials have been determined. Several free standing structures were fabricated for the measurement of the material Young’s modulus and residual stress. In addition, NCD structures were measured under resonance in order to calculate the device performance in terms of frequency and quality factor. Intrinsic and extrinsic limiting factors for both figures were identified and models have been developed in order to take into account these imperfections in the device design stages. On the other hand, III-N materials usually present large strain gradients that lead to device deformation after release. These effects have been measured and modeled for the three binary materials of the system in order to provide the interpolation points for predicting the behavior of the III-N alloys. Finally, the gathered data has been used for developing analytic and numeric models for the design of various devices. The transduction properties are studied and optimized topologies are provided. Optimized design of the following devices is presented at the last chapter of this dissertation: _ AlN=NCD piezoelectrically actuated beams applied to RF nanoswitches for large power signals. _ AlN=NCD piezoelectrically actuated circular membranes applied to tunable lenses. _ GaN based air gap tunable optical Fabry-Pérot filters with electrostatic actuation. On the whole, new optimized fabrication processes has been developed for the fabrication of NCD and III-N MEMS structures. These processing techniques was used to produce structures that led to the determination of the main mechanical properties and device parameters needed for MEMS design. Lastly, the gathered data was used for the design of various optimized demonstrator devices.
Resumo:
Hoy en día, el proceso de un proyecto sostenible persigue realizar edificios de elevadas prestaciones que son, energéticamente eficientes, saludables y económicamente viables utilizando sabiamente recursos renovables para minimizar el impacto sobre el medio ambiente reduciendo, en lo posible, la demanda de energía, lo que se ha convertido, en la última década, en una prioridad. La Directiva 2002/91/CE "Eficiencia Energética de los Edificios" (y actualizaciones posteriores) ha establecido el marco regulatorio general para el cálculo de los requerimientos energéticos mínimos. Desde esa fecha, el objetivo de cumplir con las nuevas directivas y protocolos ha conducido las políticas energéticas de los distintos países en la misma dirección, centrándose en la necesidad de aumentar la eficiencia energética en los edificios, la adopción de medidas para reducir el consumo, y el fomento de la generación de energía a través de fuentes renovables. Los edificios de energía nula o casi nula (ZEB, Zero Energy Buildings ó NZEB, Net Zero Energy Buildings) deberán convertirse en un estándar de la construcción en Europa y con el fin de equilibrar el consumo de energía, además de reducirlo al mínimo, los edificios necesariamente deberán ser autoproductores de energía. Por esta razón, la envolvente del edifico y en particular las fachadas son importantes para el logro de estos objetivos y la tecnología fotovoltaica puede tener un papel preponderante en este reto. Para promover el uso de la tecnología fotovoltaica, diferentes programas de investigación internacionales fomentan y apoyan soluciones para favorecer la integración completa de éstos sistemas como elementos arquitectónicos y constructivos, los sistemas BIPV (Building Integrated Photovoltaic), sobre todo considerando el próximo futuro hacia edificios NZEB. Se ha constatado en este estudio que todavía hay una falta de información útil disponible sobre los sistemas BIPV, a pesar de que el mercado ofrece una interesante gama de soluciones, en algunos aspectos comparables a los sistemas tradicionales de construcción. Pero por el momento, la falta estandarización y de una regulación armonizada, además de la falta de información en las hojas de datos técnicos (todavía no comparables con las mismas que están disponibles para los materiales de construcción), hacen difícil evaluar adecuadamente la conveniencia y factibilidad de utilizar los componentes BIPV como parte integrante de la envolvente del edificio. Organizaciones internacionales están trabajando para establecer las normas adecuadas y procedimientos de prueba y ensayo para comprobar la seguridad, viabilidad y fiabilidad estos sistemas. Sin embargo, hoy en día, no hay reglas específicas para la evaluación y caracterización completa de un componente fotovoltaico de integración arquitectónica de acuerdo con el Reglamento Europeo de Productos de la Construcción, CPR 305/2011. Los productos BIPV, como elementos de construcción, deben cumplir con diferentes aspectos prácticos como resistencia mecánica y la estabilidad; integridad estructural; seguridad de utilización; protección contra el clima (lluvia, nieve, viento, granizo), el fuego y el ruido, aspectos que se han convertido en requisitos esenciales, en la perspectiva de obtener productos ambientalmente sostenibles, saludables, eficientes energéticamente y económicamente asequibles. Por lo tanto, el módulo / sistema BIPV se convierte en una parte multifuncional del edificio no sólo para ser física y técnicamente "integrado", además de ser una oportunidad innovadora del diseño. Las normas IEC, de uso común en Europa para certificar módulos fotovoltaicos -IEC 61215 e IEC 61646 cualificación de diseño y homologación del tipo para módulos fotovoltaicos de uso terrestre, respectivamente para módulos fotovoltaicos de silicio cristalino y de lámina delgada- atestan únicamente la potencia del módulo fotovoltaico y dan fe de su fiabilidad por un período de tiempo definido, certificando una disminución de potencia dentro de unos límites. Existe también un estándar, en parte en desarrollo, el IEC 61853 (“Ensayos de rendimiento de módulos fotovoltaicos y evaluación energética") cuyo objetivo es la búsqueda de procedimientos y metodologías de prueba apropiados para calcular el rendimiento energético de los módulos fotovoltaicos en diferentes condiciones climáticas. Sin embargo, no existen ensayos normalizados en las condiciones específicas de la instalación (p. ej. sistemas BIPV de fachada). Eso significa que es imposible conocer las efectivas prestaciones de estos sistemas y las condiciones ambientales que se generan en el interior del edificio. La potencia nominal de pico Wp, de un módulo fotovoltaico identifica la máxima potencia eléctrica que éste puede generar bajo condiciones estándares de medida (STC: irradición 1000 W/m2, 25 °C de temperatura del módulo y distribución espectral, AM 1,5) caracterizando eléctricamente el módulo PV en condiciones específicas con el fin de poder comparar los diferentes módulos y tecnologías. El vatio pico (Wp por su abreviatura en inglés) es la medida de la potencia nominal del módulo PV y no es suficiente para evaluar el comportamiento y producción del panel en términos de vatios hora en las diferentes condiciones de operación, y tampoco permite predecir con convicción la eficiencia y el comportamiento energético de un determinado módulo en condiciones ambientales y de instalación reales. Un adecuado elemento de integración arquitectónica de fachada, por ejemplo, debería tener en cuenta propiedades térmicas y de aislamiento, factores como la transparencia para permitir ganancias solares o un buen control solar si es necesario, aspectos vinculados y dependientes en gran medida de las condiciones climáticas y del nivel de confort requerido en el edificio, lo que implica una necesidad de adaptación a cada contexto específico para obtener el mejor resultado. Sin embargo, la influencia en condiciones reales de operación de las diferentes soluciones fotovoltaicas de integración, en el consumo de energía del edificio no es fácil de evaluar. Los aspectos térmicos del interior del ambiente o de iluminación, al utilizar módulos BIPV semitransparentes por ejemplo, son aún desconocidos. Como se dijo antes, la utilización de componentes de integración arquitectónica fotovoltaicos y el uso de energía renovable ya es un hecho para producir energía limpia, pero también sería importante conocer su posible contribución para mejorar el confort y la salud de los ocupantes del edificio. Aspectos como el confort, la protección o transmisión de luz natural, el aislamiento térmico, el consumo energético o la generación de energía son aspectos que suelen considerarse independientemente, mientras que todos juntos contribuyen, sin embargo, al balance energético global del edificio. Además, la necesidad de dar prioridad a una orientación determinada del edificio, para alcanzar el mayor beneficio de la producción de energía eléctrica o térmica, en el caso de sistemas activos y pasivos, respectivamente, podría hacer estos últimos incompatibles, pero no necesariamente. Se necesita un enfoque holístico que permita arquitectos e ingenieros implementar sistemas tecnológicos que trabajen en sinergia. Se ha planteado por ello un nuevo concepto: "C-BIPV, elemento fotovoltaico consciente integrado", esto significa necesariamente conocer los efectos positivos o negativos (en términos de confort y de energía) en condiciones reales de funcionamiento e instalación. Propósito de la tesis, método y resultados Los sistemas fotovoltaicos integrados en fachada son a menudo soluciones de vidrio fácilmente integrables, ya que por lo general están hechos a medida. Estos componentes BIPV semitransparentes, integrados en el cerramiento proporcionan iluminación natural y también sombra, lo que evita el sobrecalentamiento en los momentos de excesivo calor, aunque como componente estático, asimismo evitan las posibles contribuciones pasivas de ganancias solares en los meses fríos. Además, la temperatura del módulo varía considerablemente en ciertas circunstancias influenciada por la tecnología fotovoltaica instalada, la radiación solar, el sistema de montaje, la tipología de instalación, falta de ventilación, etc. Este factor, puede suponer un aumento adicional de la carga térmica en el edificio, altamente variable y difícil de cuantificar. Se necesitan, en relación con esto, más conocimientos sobre el confort ambiental interior en los edificios que utilizan tecnologías fotovoltaicas integradas, para abrir de ese modo, una nueva perspectiva de la investigación. Con este fin, se ha diseñado, proyectado y construido una instalación de pruebas al aire libre, el BIPV Env-lab "BIPV Test Laboratory", para la caracterización integral de los diferentes módulos semitransparentes BIPV. Se han definido también el método y el protocolo de ensayos de caracterización en el contexto de un edificio y en condiciones climáticas y de funcionamiento reales. Esto ha sido posible una vez evaluado el estado de la técnica y la investigación, los aspectos que influyen en la integración arquitectónica y los diferentes tipos de integración, después de haber examinado los métodos de ensayo para los componentes de construcción y fotovoltaicos, en condiciones de operación utilizadas hasta ahora. El laboratorio de pruebas experimentales, que consiste en dos habitaciones idénticas a escala real, 1:1, ha sido equipado con sensores y todos los sistemas de monitorización gracias a los cuales es posible obtener datos fiables para evaluar las prestaciones térmicas, de iluminación y el rendimiento eléctrico de los módulos fotovoltaicos. Este laboratorio permite el estudio de tres diferentes aspectos que influencian el confort y consumo de energía del edificio: el confort térmico, lumínico, y el rendimiento energético global (demanda/producción de energía) de los módulos BIPV. Conociendo el balance de energía para cada tecnología solar fotovoltaica experimentada, es posible determinar cuál funciona mejor en cada caso específico. Se ha propuesto una metodología teórica para la evaluación de estos parámetros, definidos en esta tesis como índices o indicadores que consideran cuestiones relacionados con el bienestar, la energía y el rendimiento energético global de los componentes BIPV. Esta metodología considera y tiene en cuenta las normas reglamentarias y estándares existentes para cada aspecto, relacionándolos entre sí. Diferentes módulos BIPV de doble vidrio aislante, semitransparentes, representativos de diferentes tecnologías fotovoltaicas (tecnología de silicio monocristalino, m-Si; de capa fina en silicio amorfo unión simple, a-Si y de capa fina en diseleniuro de cobre e indio, CIS) fueron seleccionados para llevar a cabo una serie de pruebas experimentales al objeto de demostrar la validez del método de caracterización propuesto. Como resultado final, se ha desarrollado y generado el Diagrama Caracterización Integral DCI, un sistema gráfico y visual para representar los resultados y gestionar la información, una herramienta operativa útil para la toma de decisiones con respecto a las instalaciones fotovoltaicas. Este diagrama muestra todos los conceptos y parámetros estudiados en relación con los demás y ofrece visualmente toda la información cualitativa y cuantitativa sobre la eficiencia energética de los componentes BIPV, por caracterizarlos de manera integral. ABSTRACT A sustainable design process today is intended to produce high-performance buildings that are energy-efficient, healthy and economically feasible, by wisely using renewable resources to minimize the impact on the environment and to reduce, as much as possible, the energy demand. In the last decade, the reduction of energy needs in buildings has become a top priority. The Directive 2002/91/EC “Energy Performance of Buildings” (and its subsequent updates) established a general regulatory framework’s methodology for calculation of minimum energy requirements. Since then, the aim of fulfilling new directives and protocols has led the energy policies in several countries in a similar direction that is, focusing on the need of increasing energy efficiency in buildings, taking measures to reduce energy consumption, and fostering the use of renewable sources. Zero Energy Buildings or Net Zero Energy Buildings will become a standard in the European building industry and in order to balance energy consumption, buildings, in addition to reduce the end-use consumption should necessarily become selfenergy producers. For this reason, the façade system plays an important role for achieving these energy and environmental goals and Photovoltaic can play a leading role in this challenge. To promote the use of photovoltaic technology in buildings, international research programs encourage and support solutions, which favors the complete integration of photovoltaic devices as an architectural element, the so-called BIPV (Building Integrated Photovoltaic), furthermore facing to next future towards net-zero energy buildings. Therefore, the BIPV module/system becomes a multifunctional building layer, not only physically and functionally “integrated” in the building, but also used as an innovative chance for the building envelope design. It has been found in this study that there is still a lack of useful information about BIPV for architects and designers even though the market is providing more and more interesting solutions, sometimes comparable to the existing traditional building systems. However at the moment, the lack of an harmonized regulation and standardization besides to the non-accuracy in the technical BIPV datasheets (not yet comparable with the same ones available for building materials), makes difficult for a designer to properly evaluate the fesibility of this BIPV components when used as a technological system of the building skin. International organizations are working to establish the most suitable standards and test procedures to check the safety, feasibility and reliability of BIPV systems. Anyway, nowadays, there are no specific rules for a complete characterization and evaluation of a BIPV component according to the European Construction Product Regulation, CPR 305/2011. BIPV products, as building components, must comply with different practical aspects such as mechanical resistance and stability; structural integrity; safety in use; protection against weather (rain, snow, wind, hail); fire and noise: aspects that have become essential requirements in the perspective of more and more environmentally sustainable, healthy, energy efficient and economically affordable products. IEC standards, commonly used in Europe to certify PV modules (IEC 61215 and IEC 61646 respectively crystalline and thin-film ‘Terrestrial PV Modules-Design Qualification and Type Approval’), attest the feasibility and reliability of PV modules for a defined period of time with a limited power decrease. There is also a standard (IEC 61853, ‘Performance Testing and Energy Rating of Terrestrial PV Modules’) still under preparation, whose aim is finding appropriate test procedures and methodologies to calculate the energy yield of PV modules under different climate conditions. Furthermore, the lack of tests in specific conditions of installation (e.g. façade BIPV devices) means that it is difficult knowing the exact effective performance of these systems and the environmental conditions in which the building will operate. The nominal PV power at Standard Test Conditions, STC (1.000 W/m2, 25 °C temperature and AM 1.5) is usually measured in indoor laboratories, and it characterizes the PV module at specific conditions in order to be able to compare different modules and technologies on a first step. The “Watt-peak” is not enough to evaluate the panel performance in terms of Watt-hours of various modules under different operating conditions, and it gives no assurance of being able to predict the energy performance of a certain module at given environmental conditions. A proper BIPV element for façade should take into account thermal and insulation properties, factors as transparency to allow solar gains if possible or a good solar control if necessary, aspects that are linked and high dependent on climate conditions and on the level of comfort to be reached. However, the influence of different façade integrated photovoltaic solutions on the building energy consumption is not easy to assess under real operating conditions. Thermal aspects, indoor temperatures or luminance level that can be expected using building integrated PV (BIPV) modules are not well known. As said before, integrated photovoltaic BIPV components and the use of renewable energy is already a standard for green energy production, but would also be important to know the possible contribution to improve the comfort and health of building occupants. Comfort, light transmission or protection, thermal insulation or thermal/electricity power production are aspects that are usually considered alone, while all together contribute to the building global energy balance. Besides, the need to prioritize a particular building envelope orientation to harvest the most benefit from the electrical or thermal energy production, in the case of active and passive systems respectively might be not compatible, but also not necessary. A holistic approach is needed to enable architects and engineers implementing technological systems working in synergy. A new concept have been suggested: “C-BIPV, conscious integrated BIPV”. BIPV systems have to be “consciously integrated” which means that it is essential to know the positive and negative effects in terms of comfort and energy under real operating conditions. Purpose of the work, method and results The façade-integrated photovoltaic systems are often glass solutions easily integrable, as they usually are custommade. These BIPV semi-transparent components integrated as a window element provides natural lighting and shade that prevents overheating at times of excessive heat, but as static component, likewise avoid the possible solar gains contributions in the cold months. In addition, the temperature of the module varies considerably in certain circumstances influenced by the PV technology installed, solar radiation, mounting system, lack of ventilation, etc. This factor may result in additional heat input in the building highly variable and difficult to quantify. In addition, further insights into the indoor environmental comfort in buildings using integrated photovoltaic technologies are needed to open up thereby, a new research perspective. This research aims to study their behaviour through a series of experiments in order to define the real influence on comfort aspects and on global energy building consumption, as well as, electrical and thermal characteristics of these devices. The final objective was to analyze a whole set of issues that influence the global energy consumption/production in a building using BIPV modules by quantifying the global energy balance and the BIPV system real performances. Other qualitative issues to be studied were comfort aspect (thermal and lighting aspects) and the electrical behaviour of different BIPV technologies for vertical integration, aspects that influence both energy consumption and electricity production. Thus, it will be possible to obtain a comprehensive global characterization of BIPV systems. A specific design of an outdoor test facility, the BIPV Env-lab “BIPV Test Laboratory”, for the integral characterization of different BIPV semi-transparent modules was developed and built. The method and test protocol for the BIPV characterization was also defined in a real building context and weather conditions. This has been possible once assessed the state of the art and research, the aspects that influence the architectural integration and the different possibilities and types of integration for PV and after having examined the test methods for building and photovoltaic components, under operation conditions heretofore used. The test laboratory that consists in two equivalent test rooms (1:1) has a monitoring system in which reliable data of thermal, daylighting and electrical performances can be obtained for the evaluation of PV modules. The experimental set-up facility (testing room) allows studying three different aspects that affect building energy consumption and comfort issues: the thermal indoor comfort, the lighting comfort and the energy performance of BIPV modules tested under real environmental conditions. Knowing the energy balance for each experimented solar technology, it is possible to determine which one performs best. A theoretical methodology has been proposed for evaluating these parameters, as defined in this thesis as indices or indicators, which regard comfort issues, energy and the overall performance of BIPV components. This methodology considers the existing regulatory standards for each aspect, relating them to one another. A set of insulated glass BIPV modules see-through and light-through, representative of different PV technologies (mono-crystalline silicon technology, mc-Si, amorphous silicon thin film single junction, a-Si and copper indium selenide thin film technology CIS) were selected for a series of experimental tests in order to demonstrate the validity of the proposed characterization method. As result, it has been developed and generated the ICD Integral Characterization Diagram, a graphic and visual system to represent the results and manage information, a useful operational tool for decision-making regarding to photovoltaic installations. This diagram shows all concepts and parameters studied in relation to each other and visually provides access to all the results obtained during the experimental phase to make available all the qualitative and quantitative information on the energy performance of the BIPV components by characterizing them in a comprehensive way.