976 resultados para neutron detector
Resumo:
Hydrogen spillover on carbon-supported precious metal catalysts has been investigated with inelastic neutron scattering (INS) spectroscopy. The aim, which was fully realized, was to identify spillover hydrogen on the carbon support. The inelastic neutron scattering spectra of Pt/C, Ru/C, and PtRu/C fuel cell catalysts dosed with hydrogen were determined in two sets of experiments: with the catalyst in the neutron beam and, using an annular cell, with carbon in the beam and catalyst pellets at the edge of the cell excluded from the beam. The vibrational modes observed in the INS spectra were assigned with reference to the INS of a polycyclic aromatic hydrocarbon, coronene, taken as a molecular model of a graphite layer, and with the aid of computational modeling. Two forms of spillover hydrogen were identified: H at edge sites of a graphite layer (formed after ambient dissociative chemisorption of H-2), and a weakly bound layer of mobile H atoms (formed by surface diffusion of H atoms after dissociative chernisorption of H-2 at 500 K). The INS spectra exhibited characteristic riding modes of H on carbon and on Pt or Ru. In these riding modes H atoms move in phase with vibrations of the carbon and metal lattices. The lattice modes are amplified by neutron scattering from the H atoms attached to lattice atoms. Uptake of hydrogen, and spillover, was greater for the Ru containing catalysts than for the Pt/C catalyst. The INS experiments have thus directly demonstrated H spillover to the carbon support of these metal catalysts.
Resumo:
Electrospinning is a method used to produce nanoscale to microscale sized polymer fibres. In this study we electrospin 1:1 blends of deuterated and hydrogenated atactic- Polystyrene from N,N-Dimethylformamide for small angle neutron scattering experiments in order to analyse the chain conformation in the electrospun fibres. Small angle neutron scattering was carried out on randomly orientated fibre mats obtained using applied voltages of 10kV-15kV and needle tip to collector distances of 20cm and 30cm. Fibre diameters varied from 3μm – 20μm. Neutron scattering data from fibre samples were compared with bulk samples of the same polymer blend. The scattering data indicates that there are pores and nanovoiding present in the fibres; this was confirmed by scanning electron microscopy. A model that combines the scattering from the pores and the labelled polymer chains was used to extract values for the radius of gyration. The radius of gyration in the fibres is found to vary little with the applied voltage, but varies with the initial solution concentration and fibre diameter. The values for the radius of gyration in the fibres are broadly equivalent to that of the bulk state.
Resumo:
Currently microporous oxidic materials including zeolites are attracting interest as potential hydrogen storage materials. Understanding how molecular hydrogen interacts with these materials is important in the rational development of hydrogen storage materials and is also challenging theoretically. In this paper, we present an incoherent inelastic neutron scattering (INS) study of the adsorption of molecular hydrogen and hydrogen deuteride (HD) in a copper substituted ZSM5 zeolite varying the hydrogen dosage and temperature. We have demonstrated how inelastic neutron scattering can help us understand the interaction of H-2 molecules with a binding site in a particular microporous material, Cu ZSM5, and by implication of other similar materials. The H-2 molecule is bound as a single species lying parallel with the surface. As H-2 dosing increases, lateral interactions between the adsorbed H-2 molecules become apparent. With rising temperature of measurement up to 70 K (the limit of our experiments), H-2 molecules remain bound to the surface equivalent to a liquid or solid H-2 phase. The implication is that hydrogen is bound rather strongly in Cu ZSM5. Using the simple model for the anisotropic interaction to calculate the energy levels splitting, we found that the measured rotational constant of the hydrogen molecule is reduced as a consequence of adsorption by the Cu ZSM5. From the decrease in total signal intensity with increasing temperature, we were able to observe the conversion of para-hydrogen into ortho-hydrogen at paramagnetic centres and so determine the fraction of paramagnetic sites occupied by hydrogen molecules, ca. 60%. (c) 2006 Elsevier B.V. All rights reserved.
Resumo:
An inelastic neutron scattering (INS) study of the rotational - vibrational spectrum of dihydrogen sorbed by zeolite X having substituted sodium, calcium and zinc cations is reported. The rotational - vibrational spectrum of H-2 was observed at low energy transfer ( below ca. 25 meV, 202 cm(-1)); the vibration was that of the H-2 molecule against the binding site (H-2 - X, not H - H). The vibration frequency was proportional to the polarising power of the cation (Na+ < Ca2+ < Zn2+). Polarisation of the H-2 molecule dominated the interaction of H-2 with this binding site. The total scattering intensity was proportional to the dihydrogen dose. However the vibrational intensities became constant at ca. 0.3 wt% showing that the H-2 binding sites had saturated. Additional dihydrogen appeared as unbound or weakly bound dihydrogen exhibiting recoil.
Resumo:
We report an inelastic neutron scattering (INS) study of the rotational–vibrational spectrum of dihydrogen sorbed by zeolite CaX. In the low energy (<200 cm−1) INS spectrum of adsorbed H2 we observe the rotational–vibrational spectrum of H2, where the vibration is that of the H2 molecule against the binding site (i.e. H2–X, not H–H). We have observed for the first time the vibrational overtones of the hydrogen molecule against the adsorption surface up to sixth order. These vibrations are usually forbidden in INS spectroscopy because of the selection rules imposed by the spin flip event required. In our case we are able to observe such a vibration because the rotational transition J(1 ← 0) convolutes the vibrational spectrum. This paper reports the effect for the first time.
Resumo:
We have used high energy transfer (HET) inelastic neutron scattering spectroscopy to measure the vibrational modes in the spectra of hydroxyapatite, bone and brushite to confirm our earlier work that only a fraction of the hydroxyl groups in bone mineral are substituted. The HET spectra are better observed due to the higher scattering cross section of hydrogen compared with the other elements in the calcium phosphate compounds. (C) 2003 Elsevier Science B.V. All rights reserved.
Resumo:
The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.
Resumo:
Wireless Personal Area Networks (WPANs) are offering high data rates suitable for interconnecting high bandwidth personal consumer devices (Wireless HD streaming, Wireless-USB and Bluetooth EDR). ECMA-368 is the Physical (PHY) and Media Access Control (MAC) backbone of many of these wireless devices. WPAN devices tend to operate in an ad-hoc based network and therefore it is important to successfully latch onto the network and become part of one of the available piconets. This paper presents a new algorithm for detecting the Packet/Fame Sync (PFS) signal in ECMA-368 to identify piconets and aid symbol timing. The algorithm is based on correlating the received PFS symbols with the expected locally stored symbols over the 24 or 12 PFS symbols, but selecting the likely TFC based on the highest statistical mode from the 24 or 12 best correlation results. The results are very favorable showing an improvement margin in the order of 11.5dB in reference sensitivity tests between the required performance using this algorithm and the performance of comparable systems.
A PIC detector for distributed space-time block coding: 4 relay nodes with imperfect synchronisation
Resumo:
Most research on D-STBC has assumed that cooperative relay nodes are perfectly synchronised. Since such an assumption is difficult to achieve in many practical systems, this paper proposes a simple yet optimum detector for the case of two relay nodes, which proves to be much more robust against timing misalignment than the conventional STBC detector.
Resumo:
A parallel interference cancellation (PIC) detection scheme is proposed to suppress the impact of imperfect synchronisation. By treating as interference the extra components in the received signal caused by timing misalignment, the PIC detector not only offers much improved performance but also retains a low structural and computational complexity.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
This paper presents a unique two-stage image restoration framework especially for further application of a novel rectangular poor-pixels detector, which, with properties of miniature size, light weight and low power consumption, has great value in the micro vision system. To meet the demand of fast processing, only a few measured images shifted up to subpixel level are needed to join the fusion operation, fewer than those required in traditional approaches. By maximum likelihood estimation with a least squares method, a preliminary restored image is linearly interpolated. After noise removal via Canny operator based level set evolution, the final high-quality restored image is achieved. Experimental results demonstrate effectiveness of the proposed framework. It is a sensible step towards subsequent image understanding and object identification.
Resumo:
The High Resolution Dynamics Limb Sounder is described, with particular reference to the atmospheric measurements to be made and the rationale behind the measurement strategy. The demands this strategy places on the filters to be used in the instrument and the designs to which this leads to are described. A second set of filters at an intermediate image plane to reduce "Ghost Imaging" is discussed together with their required spectral properties. A method of combining the spectral characteristics of the primary and secondary filters in each channel are combined together with the spectral response of the detectors and other optical elements to obtain the system spectral response weighted appropriately for the Planck function and atmospheric limb absorption. This method is used to demonstrate whether the out-of-band spectral blocking requirement for a channel is being met and an example calculation is demonstrated showing how the blocking is built up for a representative channel. Finally, the techniques used to produce filters of the necessary sub-millimetre sizes together with the testing methods and procedures used to assess the environmental durability and establish space flight quality are discussed.