Sp1 functions in a chromatin-dependent manner to augment human alpha-globin promoter activity.

The 5' flanking region of the human alpha-globin gene is highly G + C rich and contains multiple copies of the consensus sequence for the Sp1 binding site. We investigated the role of this G + C-rich region in augmenting alpha-globin promoter activity in the presence of the far-upstream alpha-globin enhancer, HS-40. We show that in transiently transfected erythroid cells, deletion of the alpha-globin G + C-rich 5' flanking region has no effect on alpha-globin promoter activity. However, upon stable integration into chromatin, deletion of this region causes a nearly 90% decrease in promoter activity compared with expression from an alpha-globin promoter retaining this region. These results suggest that the alpha-globin G + C-rich 5' flanking region augments alpha-globin promoter activity in a chromatin-dependent manner. We further show that this G + C-rich region is required for the activation of alpha-globin gene expression during erythroid differentiation. Finally, we show by both footprint analysis and functional assays that the ability of the G + C-rich region to increase alpha-globin promoter activity from a stably integrated alpha-globin gene is mediated by its multiple binding sites for the transcription factor Sp1.

Integration host factor suppresses promiscuous activation of the sigma 54-dependent promoter Pu of Pseudomonas putida.

In the presence of m-xylene, the Pu promoter of the TOL plasmid of Pseudomonas putida is activated by the prokaryotic enhancer-binding protein XylR. The intervening DNA segment between the upstream activating sequences (UASs) and those for RNA polymerase binding contains an integration host factor (IHF) attachment site that is required for full transcriptional activity. In the absence of IHF, the Pu promoter can be cross-activated by other members of the sigma 54-dependent family of regulatory proteins. Such illegitimate activation does not require the binding of the heterologous regulators to DNA and it is suppressed by bent DNA structures, either static or protein induced, between the promoter core elements (UAS and RNA polymerase recognition sequence). The role of IHF in some sigma 54 promoters is, therefore, not only a structural aid for assembling a correct promoter geometry but also that of an active suppressor (restrictor) of promiscuous activation by heterologous regulators for increased promoter specificity.

Transcription regulation by inflexibility of promoter DNA in a looped complex.

The gal operon of Escherichia coli is negatively regulated by repressor binding to bipartite operators separated by 11 helical turns of DNA. Synergistic binding of repressor to separate sites on DNA results in looping, with the intervening DNA as a topologically closed domain containing the two promoters. A closed DNA loop of 11 helical turns, which is in-flexible to torsional changes, disables the promoters either by resisting DNA unwinding needed for open complex formation or by impeding the processive DNA contacts by an RNA polymerase in flux during transcription initiation. Interaction between two proteins bound to different sites on DNA modulating the activity of the intervening segment toward other proteins by allostery may be a common mechanism of regulation in DNA-multiprotein complexes.

Expression of a flower-specific Myb protein in leaf cells using a viral vector causes ectopic activation of a target promoter.

The promoter of the bean PAL2 gene (encoding phenylalanine ammonia-lyase; EC 4.3.1.5) is a model for studies of tissue-restricted gene expression in plants. Petal epidermis is one of the tissues in which this promoter is activated in tobacco. Previous work suggested that a major factor establishing the pattern of PAL2 expression in tobacco petals is the tissue distribution of a protein closely related to Myb305, which is a Myb-like transcriptional activator from snapdragon. In the present work, we show that Myb305 expression in tobacco leaves causes ectopic activation of the PAL2 promoter. To achieve Myb305 expression in planta, a viral expression vector was used. This approach combines the utility of transient assays with the possibility of direct biochemical detection of the introduced factor and may have wider application for studying the function of plant transcription factors.

Identification of human granzyme B promoter regulatory elements interacting with activated T-cell-specific proteins: implication of Ikaros and CBF binding sites in promoter activation.

Granzyme B serine protease is found in the granules of activated cytotoxic T cells and in natural and lymphokine-activated killer cells. This protease plays a critical role in the rapid induction of target cell DNA fragmentation. The DNA regulatory elements that are responsible for the specificity of granzyme B gene transcription in activated T-cells reside between nt -148 and +60 (relative to the transcription start point at +1) of the human granzyme B gene promoter. This region contains binding sites for the transcription factors Ikaros, CBF, Ets, and AP-1. Mutational analysis of the human granzyme B promoter reveals that the Ikaros binding site (-143 to -114) and the AP-1/CBF binding site (-103 to -77) are essential for the activation of transcription in phytohemagglutinin-activated peripheral blood lymphocytes, whereas mutation of the Ets binding site does not affect promoter activity in these cells.

Domains of transcription factor Sp1 required for synergistic activation with sterol regulatory element binding protein 1 of low density lipoprotein receptor promoter.

Feedback regulation of transcription from the low density lipoprotein (LDL) receptor gene is fundamentally important in the maintenance of intracellular sterol balance. The region of the LDL receptor promoter responsible for normal sterol regulation contains adjacent binding sites for the ubiquitous transcription factor Sp1 and the cholesterol-sensitive sterol regulatory element-binding proteins (SREBPs). Interestingly, both are essential for normal sterolmediated regulation of the promoter. The cooperation by Sp1 and SREBP-1 occurs at two steps in the activation process. SREBP-1 stimulates the binding of Sp1 to its adjacent recognition site in the promoter followed by enhanced stimulation of transcription after both proteins are bound to DNA. In the present report, we have defined the protein domains of Sp1 that are required for both synergistic DNA binding and transcriptional activation. The major activation domains of Sp1 that have previously been shown to be essential to activation of promoters containing multiple Sp1 sites are required for activation of the LDL receptor promoter. Additionally, the C domain is also crucial. This slightly acidic approximately 120-amino acid region is not required for efficient synergistic activation by multiple Sp1 sites or in combination with other recently characterized transcriptional regulators. We also show that Sp1 domain C is essential for full, enhanced DNA binding by SREBP-1. Taken together with other recent studies on the role of Sp1 in promoter activation, the current experiments suggest a unique combinatorial mechanism for promoter activation by two distinct transcription factors that are both essential to intracellular cholesterol homeostasis.

Induction of ubiquitin-conjugating enzymes during terminal erythroid differentiation.

A global cellular reorganization occurs during the reticulocyte stage of erythroid differentiation. This reorganization is accomplished partly through programmed protein degradation. The selection of proteins for degradation can be mediated by covalent attachment of ubiquitin. We have cloned cDNAs encoding two ubiquitin-conjugating (E2) enzymes, E2-20K and E2-230K, and found their genes to be strongly induced during the differentiation of erythroblasts into reticulocytes. Induction of the E2-20K and E2-230K genes is specific, as transcript levels for at least two other ubiquitinating enzymes fall during erythroblast differentiation. In contrast to most proteins induced in reticulocytes, E2-20K and E2-230K enzymes are present at strongly reduced levels in erythrocytes and thus decline in abundance as reticulocyte maturation is completed. This result suggests that both enzymes function during the reticulocyte stage, when enhanced protein degradation has been observed. These data implicate regulated components of the ubiquitin conjugation machinery in erythroid differentiation.

The su(Hw) protein bound to gypsy sequences in one chromosome can repress enhancer-promoter interactions in the paired gene located in the other homolog.

The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.

Dual transcriptional control by Ear3/COUP: negative regulation through the DR1 direct repeat and positive regulation through a sequence downstream of the transcriptional start site of the mouse mammary tumor virus promoter.

Ear3/COUP is an orphan member of the steroid/thyroid hormone receptor superfamily of transcription factors and binds most tightly to a direct repeat of AGGTCA with 1 nucleotide in between (DR1). Ear3/COUP also binds with a similar affinity to the palindromic thyroid hormone response element (TRE). This binding preference of Ear3/COUP is same as that of the retinoid X receptor (RXR), which is another member of the superfamily. In the present study, we identified a sequence responsible for Ear3/COUP-mediated transactivation in the region downstream of the transcription start site of the mouse mammary tumor virus promoter. This cis-acting sequence was unresponsive to RXR. When the DR1 or TRE sequence was added upstream of the promoter, transactivation by Ear3/COUP was completely abolished, whereas RXR enhanced transcription from the promoter. The mode of action of Ear3/COUP could be utilized to control complex gene expressions in morphogenesis, homeostasis, and development.

A mutation in the promoter of the lipoprotein lipase (LPL) gene in a patient with familial combined hyperlipidemia and low LPL activity.

We have identified a naturally occurring mutation in the promoter of the lipoprotein lipase (LPL) gene. One of 20 patients with familial combined hyperlipidemia (FCHL) and reduced levels of postheparin plasma LPL activity was found to be a heterozygote carrier of this mutation. The mutation, a T-->C substitution at nt -39, occurred in the binding site of the transcription factor Oct-1. As a result, the transcriptional activity of the mutant promoter was < 15% of wild type, as determined by transfection studies in the human macrophage-like cell line THP-1. This decrease in promoter activity was observed in undifferentiated as well as in phorbol ester-differentiated THP-1 cells. Furthermore, the inductive effect of elevating the levels of intracellular cAMP was equally reduced. This mutation was not present among 20 FCHL patients with normal plasma LPL levels nor has it been reported among individuals with familial LPL deficiency. Thus, heterozygosity for LPL promoter mutations may be one of several factors that contribute to the etiology of FCHL.

Reconstitution of p53-ubiquitinylation reactions from purified components: the role of human ubiquitin-conjugating enzyme UBC4 and E6-associated protein (E6AP).

The E6 protein of the high-risk human papillomaviruses inactivates the tumor suppressor protein p53 by stimulating its ubiquitinylation and subsequent degradation. Ubiquitinylation is a multistep process involving a ubiquitin-activating enzyme, one of many distinct ubiquitin-conjugating enzymes, and in certain cases, a ubiquitin ligase. In human papillomavirus-infected cells, E6 and the E6-associated protein are thought to act as a ubiquitin-protein ligase in the ubiquitinylation of p53. Here we describe the cloning of a human ubiquitin-conjugating enzyme that specifically ubiquitinylates E6-associated protein. Furthermore, we define the biochemical pathway of p53 ubiquitinylation and demonstrate that in vivo inhibition of various components in the pathway leads to an inhibition of E6-stimulated p53 degradation.

Phosphorylation of ubiquitin-activating enzyme in cultured cells.

Ubiquitin-activating enzyme, E1, is the first enzyme in the pathway leading to formation of ubiquitin-protein conjugates. E1 exists as two isoforms in human cells which are separable by electrophoresis. These isoforms migrate with apparent molecular sizes of 110 kDa and 117 kDa in SDS/polyacrylamide gels. Immunoprecipitation of E1 from lysates of HeLa cells metabolically labeled with [32P]phosphate indicated the presence of a phosphorylated form of E1 which migrates at 117 kDa. Phospho amino acid analysis identified serine as the phosphorylated residue in E1. Phosphorylated E1 was also detected in normal and transformed cells from another human cell line. Phosphatase-catalyzed dephosphorylation of E1 in vitro did not eliminate the 117-kDa E1 isoform detected by Coomassie staining after SDS/polyacrylamide gel electrophoresis, thereby demonstrating that phosphorylation is not the sole structural feature differentiating the isoforms of E1. These observations suggest new hypotheses concerning mechanisms of metabolic regulation of the ubiquitin conjugation pathway.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

A family of proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase.

E6-AP is a 100-kDa cellular protein that interacts with the E6 protein of the cancer-associated human papillomavirus types 16 and 18. The E6/E6-AP complex binds to and targets the p53 tumor-suppressor protein for ubiquitin-mediated proteolysis. E6-AP is an E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. The amino acid sequence of E6-AP shows similarity to a number of protein sequences over an approximately 350-aa region corresponding to the carboxyl termini of both E6-AP and the E6-AP-related proteins. Of particular note is a conserved cysteine residue within the last 32-34 aa, which in E6-AP is likely to be the site of ubiquitin thioester formation. Two of the E6-AP-related proteins, a rat 100-kDa protein and a yeast 95-kDa protein (RSP5), both of previously unknown function, are shown here to form thioesters with ubiquitin. Mutation of the conserved cysteine residue of these proteins destroys their ability to accept ubiquitin. These data strongly suggest that the rat 100-kDa protein and RSP5, as well as the other E6-AP-related proteins, belong to a class of functionally related E3 ubiquitin-protein ligases, defined by a domain homologous to the E6-AP carboxyl terminus (hect domain).

Promoter architecture in the flagellar regulon of Bacillus subtilis: high-level expression of flagellin by the sigma D RNA polymerase requires an upstream promoter element.

Flagellin is one of the most abundant proteins in motile bacteria, yet its expression requires a low abundance sigma factor (sigma 28). We show that transcription from the Bacillus subtilis flagellin promoter is stimulated 20-fold by an upstream A+T-rich region [upstream promoter (UP) element] both in vivo and in vitro. This UP element is contacted by sigma 28 holoenzyme bound at the flagellin promoter and binds the isolated alpha 2 subassembly of RNA polymerase. The UP element increases the affinity of RNA polymerase for the flagellin promoter and stimulates transcription when initiation is limited by the rate of RNA polymerase binding. Comparison with other promoters in the flagellar regulon reveals a bipartite architecture: the -35 and -10 elements confer specificity for sigma 28, while promoter strength is determined largely by upstream DNA sequences.