Distinctive role of integrin-mediated adhesion in TNF-induced PKB/Akt and NF-kappaB activation and endothelial cell survival.

Tumor necrosis factor (TNF) is a pro-inflammatory cytokine exerting pleiotropic effects on endothelial cells. Depending on the vascular context it can induce endothelial cell activation and survival or death. The microenvironmental cues determining whether endothelial cells will survive or die, however, have remained elusive. Here we report that integrin ligation acts permissive for TNF-induced protein kinase B (PKB/Akt) but not nuclear factor (NF)-kappaB activation. Concomitant activation of PKB/Akt and NF-kappaB is essential for the survival of endothelial cells exposed to TNF. Active PKB/Akt strengthens integrin-dependent endothelial cell adhesion, whereas disruption of actin stress fibers abolishes the protective effect of PKB/Akt. Integrin-mediated adhesion also represses TNF-induced JNK activation, but JNK activity is not required for cell death. The alphaVbeta3/alphaVbeta5 integrin inhibitor EMD121974 sensitizes endothelial cells to TNF-dependent cytotoxicity and active PKB/Akt attenuates this effect. Interferon gamma synergistically enhanced TNF-induced endothelial cell death in all conditions tested. Taken together, these observations reveal a novel permissive role for integrins in TNF-induced PKB/Akt activation and prevention of TNF-induced death distinct of NF-kappaB, and implicate the actin cytoskeleton in PKB/Akt-mediated cell survival. The sensitizing effect of EMD121974 on TNF cytotoxicity may open new perspectives to the therapeutic use of TNF as anticancer agent.

Protective effect of intravitreal injection of vasoactive intestinal peptide-loaded liposomes on experimental autoimmune uveoretinitis.

PURPOSE: The aim of this study was to investigate the effect of a single intravitreal (i.v.t.) injection of vasoactive intestinal peptide (VIP) loaded in rhodamine-conjugated liposomes (VIP-Rh-Lip) on experimental autoimmune uveoretinitis (EAU). METHODS: An i.v.t. injection of VIP-Rh-Lip, saline, VIP, or empty-(E)-Rh-Lip was performed simultaneously, either 6 or 12 days after footpad immunization with retinal S-antigen in Lewis rats. Clinical and histologic scores were determined. Immunohistochemistry and cytokine quantification by multiplex enzyme-linked immunosorbent assay were performed in ocular tissues. Systemic immune response was determined at day 20 postimmunization by measuring proliferation and cytokine secretion of cells from inguinal lymph nodes (ILNs) draining the immunization site, specific delayed-type hypersensitivity (DTH), and the serum concentration of cytokines. Ocular and systemic biodistribution of VIP-Rh-Lip was studied in normal and EAU rats by immunofluorescence. RESULTS: The i.v.t. injection of VIP-Rh-Lip performed during the afferent, but not the efferent, phase of the disease reduced clinical EAU and protected against retinal damage. No effect was observed after saline, E-Rh-Lip, or VIP injection. VIP-Rh-Lip and VIP were detected in intraocular macrophages and in lymphoid organs. In VIP-Rh-Lip-treated eyes, macrophages expressed transforming growth factor-beta2, low levels of major histocompatibility complex class II, and nitric oxide synthase-2. T-cells showed activated caspase-3 with the preservation of photoreceptors. Intraocular levels of interleukin (IL)-2, interferon-gamma (IFN-gamma), IL-17, IL-4, GRO/KC, and CCL5 were reduced with increased IL-13. At the systemic level, treatment reduced retinal soluble autoantigen lymphocyte proliferation, decreased IL-2, and increased IL-10 in ILN cells, and diminished specific DTH and serum concentration of IL-12 and IFN-gamma. CONCLUSIONS: An i.v.t. injection of VIP-Rh-Lip, performed during the afferent stage of immune response, reduced EAU pathology through the immunomodulation of intraocular macrophages and deviant stimulation of T-cells in ILN. Thus, the encapsulation of VIP within liposomes appears as an effective strategy to deliver VIP into the eye and is an efficient means of the prevention of EAU severity.

Long-term close follow-up of chorioretinal lesions in presumed ocular tuberculosis.

PURPOSE: To evaluate the long-term outcome (up to 7 years) of presumed ocular tuberculosis (TB) when the therapeutic decision was based on WHO guidelines. METHODS: Twelve out of 654 new uveitic patients (1998-2004) presented with choroiditis and positive tuberculosis skin test (TST) (skin lesion diameter >15 mm). Therapy was administered according to WHO recommendations after ophthalmic and systemic investigation. The area size of ocular lesions at presentation and after therapy, measured on fluorescein and indocyanine green angiographies, was considered the primary outcome. Relapse of choroiditis was considered a secondary outcome. The T-SPOT TB test was performed when it became available. RESULTS: Visual acuity significantly improved after therapy (p=0.0357). The mean total surface of fluorescein lesions at entry was 44.8 ± 20.9 (arbitrary units) and decreased to 32.5 ± 16.9 after therapy (p=0.0165). The mean total surface of indocyanine green lesions at entry was 24.5 ± 13.3 and decreased to 10.8 ± 5.4 after therapy (p=0.0631). The T-SPOT TB revealed 2 false TST-positive results. The mean follow-up was 4.5 ± 1.5 years. Two relapses out of 10 confirmed ocular TB was observed after complete lesion healing, 2.5 years and 4.5 years after therapy, respectively. CONCLUSIONS: A decrease of ocular lesion mean size and a mean improvement of VA were observed after antituberculous therapy. Our long-term follow-up of chorioretinal lesions demonstrated relapse of ocular tuberculosis in 10% of patients with confirmed ocular TB, despite complete initial retinal scarring.

Pro-inflammatory cytokines induce the transcription factors C/EBPbeta and C/EBPdelta in astrocytes.

The transcription factors CCAAT/enhancer binding protein (C/EBP)-beta and -delta are key regulators for the expression of the acute phase genes in the liver, such as complement component C3 and antichymotrypsin. In the brain, these acute phase proteins are produced in response to pro-inflammatory cytokines by the reactive astrocytes, in particular those surrounding the amyloid plaques of Alzheimer's disease brains. Here we show that lipopolysaccharides (LPS), IL-1beta, and TNFalpha induce the expression of the c/ebpbeta and -delta genes in mouse primary astrocytes. This induction precedes the expression of the acute phase genes coding for the complement component C3 and the mouse homologue of antichymotrypsin. The induction of these two acute phase genes by LPS is blocked by cycloheximide, whereas this protein synthesis inhibitor does not affect the expression of the c/ebp genes. Altogether, our data support a role as immediate-early genes for c/ebpbeta and -delta, whose expression is induced by pro-inflammatory cytokines in mouse cortical astrocytes. In the liver, these transcription factors are known to play an important role in inflammation and energy metabolism regulation. Therefore, C/EBPbeta and -delta could be pivotal transcription factors involved in brain inflammation, in addition to their previously demonstrated role in brain glycogen metabolism regulation (Cardinaux and Magistretti. J Neurosci 16:919-929, 1996).

Screening for latent tuberculosis infection among undocumented immigrants in Swiss healthcare centres; a descriptive exploratory study.

BACKGROUND: Migration is one of the major causes of tuberculosis in developed countries. Undocumented patients are usually not screened at the border and are not covered by a health insurance increasing their risk of developing the disease unnoticed. Urban health centres could help identify this population at risk. The objective of this study is to assess the prevalence of latent tuberculosis infection (LTBI) and adherence to preventive treatment in a population of undocumented immigrant patients. METHODS: All consecutive undocumented patients that visited two urban healthcare centres for vulnerable populations in Lausanne, Switzerland for the first time were offered tuberculosis screening with an interferon-gamma assay. Preventive treatment was offered if indicated. Adherence to treatment was evaluated monthly over a nine month period. RESULTS: Of the 161 participants, 131 (81.4%) agreed to screening and 125 had complete examinations. Twenty-four of the 125 patients (19.2%; CI95% 12.7;27.2) had positive interferon-gamma assay results, two of which had active tuberculosis. Only five patients with LTBI completed full preventive treatments. Five others initiated the treatment but did not follow through. CONCLUSION: Screening for tuberculosis infection in this hard-to-reach population is feasible in dedicated urban clinics, and the prevalence of LTBI is high in this vulnerable population. However, the low adherence to treatment is an important public health concern, and new strategies are needed to address this problem.

Innate Immune Sensing of Fusarium culmorum by Mouse Dendritic Cells.

Chronic inhalation of grain dust is associated with asthma and chronic bronchitis in grain worker populations. Exposure to fungal particles was postulated to be an important etiologic agent of these pathologies. Fusarium species frequently colonize grain and straw and produce a wide array of mycotoxins that impact human health, necessitating an evaluation of risk exposure by inhalation of Fusarium and its consequences on immune responses. Data showed that Fusarium culmorum is a frequent constituent of aerosols sampled during wheat harvesting in the Vaud region of Switzerland. The aim of this study was to examine cytokine/chemokine responses and innate immune sensing of F. culmorum in bone-marrow-derived dendritic cells and macrophages. Overall, dendritic cells and macrophages responded to F. culmorum spores but not to its secreted components (i.e., mycotoxins) by releasing large amounts of macrophage inflammatory protein (MIP)-1α, MIP-1β, MIP-2, monocyte chemoattractant protein (MCP)-1, RANTES, and interleukin (IL)-12p40, intermediate amounts of tumor necrosis factor (TNF), IL-6, IL-12p70, IL-33, granulocyte colony-stimulating factor (G-CSF), and interferon gamma-induced protein (IP-10), but no detectable amounts of IL-4 and IL-10, a pattern of mediators compatible with generation of Th1 or Th17 antifungal protective immune responses rather than with Th2-dependent allergic responses. The sensing of F. culmorum spores by dendritic cells required dectin-1, the main pattern recognition receptor involved in β-glucans detection, but likely not MyD88 and TRIF-dependent Toll-like receptors. Taken together, our results indicate that F. culmorum stimulates potently innate immune cells in a dectin-1-dependent manner, suggesting that inhalation of F. culmorum from grain dust may promote immune-related airway diseases in exposed worker populations.

Absence of nonhematopoietic MHC class II expression protects mice from experimental autoimmune myocarditis.

Experimental autoimmune myocarditis (EAM) is a CD4(+) T-cell-mediated model of human inflammatory dilated cardiomyopathies. Heart-specific CD4(+) T-cell activation is dependent on autoantigens presented by MHC class II (MHCII) molecules expressed on professional APCs. In this study, we addressed the role of inflammation-induced MHCII expression by cardiac nonhematopoietic cells on EAM development. EAM was induced in susceptible mice lacking inducible expression of MHCII molecules on all nonhematopoietic cells (pIV-/- K14 class II transactivator (CIITA) transgenic (Tg) mice) by immunization with α-myosin heavy chain peptide in CFA. Lack of inducible nonhematopoietic MHCII expression in pIV-/- K14 CIITA Tg mice conferred EAM resistance. In contrast, cardiac pathology was induced in WT and heterozygous mice, and correlated with elevated cardiac endothelial MHCII expression. Control mice with myocarditis displayed an increase in infiltrating CD4(+) T cells and in expression of IFN-γ, which is the major driver of nonhematopoietic MHCII expression. Mechanistically, IFN-γ neutralization in WT mice shortly before disease onset resulted in reduced cardiac MHCII expression and pathology. These findings reveal a previously overlooked contribution of IFN-γ to induce endothelial MHCII expression in the heart and to progress cardiac pathology during myocarditis.

Development of an indirect ELISA to detect Corynebacterium pseudotuberculosis specific antibodies in sheep employing T1 strain culture supernatant as antigen

Corynebacterium pseudotuberculosis is the etiologic agent of caseous lymphadenitis (CLA), a chronic disease that affects goats and sheep, characterized by granuloma formation in subcutaneous and internal lymph nodes. CLA causes significant economic losses to commercial goat herds. In this study, we aimed to test secreted antigens secreted from T1 strain bacteria grown in brain heart infusion (BHI) broth in an indirect ELISA system to determine the presence of specific immunoglobulins against C. pseudotuberculosis. We analyzed the BHI antigen electrophoretic profile and the recognition pattern by infected sheep sera samples. The ELISA results were compared with multiplex PCR assay and IFN-gamma production. The ELISA was able to discriminate between negative and positive animals, with a sensitivity of 89% and a specificity of 99%, using microbiological isolation as gold standard. When this assay was compared with multiplex PCR and specific IFN-gamma quantification, six discrepant results were found among thirty-two samples. We concluded that the ELISA using antigens secreted from C. pseudotuberculosis T1 strain growth in BHI broth culture can be used for the serodiagnosis of CLA in sheep.

Cytokines in innate and acquired immunity to Trypanosoma cruzi infection

Resistance to Trypanosoma cruzi infections is critically dependent on cytokine-mediated activation of cell-mediated immune effector mechanisms. This review focuses on the role of IL-10, TNF-a, IFN-g and IL-12 in controlling T. cruzi replication by the innate and specific immune systems of the vertebrate host. A study performed on mice with disrupted recombinase-activating genes (RAG/KO), which lack T and B lymphocytes, revealed the importance of IL-12, IFN-g and TNF-a in the resistance against T. cruzi mediated by the innate immune system. In addition, data from experiments using IL-10 KO, RAG/KO and double RAG/IL-10 KO mice indicating an in vivo regulatory role of IL-10 in innate and T. cruzi-specific immunity are discussed

Serum cytokine levels in autoimmune and non-autoimmune hyperthyroid states

Although the role of interleukin-2 (IL-2) and interferon gamma (gIFN) is still poorly understood in hyperthyroid diseases, it is reasonable to assume that these cytokines may be present at higher levels in Graves' disease (GD) than in other primarily non-autoimmune thyroid diseases. In order to look for an easy method to distinguish GD from primarily non-autoimmune causes of hyperthyroidism, we compared 13 healthy individuals with 21 treated and untreated hyperthyroid GD patients and with 19 patients with hyperthyroidism due to other etiologies: 7 cases of multinodular goiter, 5 cases of excessive hormone replacement and 7 cases of amiodarone-associated hyperthyroidism. All patients presented low TSH levels and a dubious clinical thyroid state. We found a good correlation between TSH and serum IL-2 levels (r = 0.56; P<0.01). Serum IL-2 (P<0.01) and gIFN (P<0.01) levels were lower in the hyperthyroid group of patients than in control subjects, suggesting a depressed TH1 pattern in the T-cell subset of hyperthyroid patients. GD had normal IL-2 levels, while patients with other forms of thyrotoxicosis presented decreased IL-2 levels (P<0.05). There was no difference between treated and untreated GD patients. We suggest that the direct measurement of serum IL-2 level may help to confirm hyperthyroidism caused by GD.

The pathogenesis of tropical spastic paraparesis/human T-cell leukemia type I-associated myelopathy

Tropical spastic paraparesis/human T-cell leukemia type I-associated myelopathy (TSP/HAM) is caused by a human T-cell leukemia virus type I (HTLV-I) after a long incubation period. TSP/HAM is characterized by a chronic progressive paraparesis with sphincter disturbances, no/mild sensory loss, the absence of spinal cord compression and seropositivity for HTLV-I antibodies. The pathogenesis of this entity is not completely known and involves a multivariable phenomenon of immune system activation against the presence of HTLV-I antigens, leading to an inflammatory process and demyelination, mainly in the thoracic spinal cord. The current hypothesis about the pathogenesis of TSP/HAM is: 1) presence of HTLV-I antigens in the lumbar spinal cord, noted by an increased DNA HTLV-I load; 2) CTL either with their lytic functions or release/production of soluble factors, such as CC-chemokines, cytokines, and adhesion molecules; 3) the presence of Tax gene expression that activates T-cell proliferation or induces an inflammatory process in the spinal cord; 4) the presence of B cells with neutralizing antibody production, or complement activation by an immune complex phenomenon, and 5) lower IL-2 and IFN-gamma production and increased IL-10, indicating drive to a cytokine type 2 pattern in the TSP/HAM subjects and the existence of a genetic background such as some HLA haplotypes. All of these factors should be implicated in TSP/HAM and further studies are necessary to investigate their role in the development of TSP/HAM.

Normal expression of IFN-gammaR in four patients with uncommon mycobacterial infection phenotypes

Several primary immunodeficiency diseases affecting the interleukin 12/interferon gamma (IFN-gamma) pathway have been identified, most of them characterized by recurrent and protracted infections produced by intracellular microorganisms, particularly by several species of mycobacteria. In the present study we analyzed the expression of IFN-gamma receptor (IFN-gammaR) and signal transducer and activator of transcription 1 (STAT-1) in 4 children with Mycobacterium tuberculosis infection of uncommon clinical presentation. These molecules were evaluated by flow cytometry and Western blotting in B cells transformed with Epstein-Barr virus and mutations were scanned by single-strand conformational polymorphisms and DNA sequencing. The expression of IFN-gammaR1 was normal in all 4 patients. The genetic analysis of IFN-gammaR1 and IFN-gammaR2 coding sequences did not reveal any mutation. The expression of the STAT-1 molecule was similar in patients and healthy controls; however, when the phosphorylation of this transcription factor in response to IFN-gamma activation was evaluated by Western blot, a significant lower signal was evident in one patient. These data indicate that there are no alterations in the expression or function of the IFN-gammaR chains in these patients. However, the low level of STAT-1 phosphorylation found in one of these patients might be explained by a defect in one of the molecules involved in the signal transduction pathway after IFN-gamma interacts with its receptor. In the other three patients the inability to eliminate the mycobacteria may be due to a defect in another effector mechanism of the mononuclear phagocytes.

Plasma cytokine response, lipid peroxidation and NF-κB activation in skeletal muscle following maximum progressive swimming

Our objective was to determine lipid peroxidation and nuclear factor-κB (NF-κB) activation in skeletal muscle and the plasma cytokine profile following maximum progressive swimming. Adult male Swiss mice (N = 15) adapted to the aquatic environment were randomly divided into three groups: immediately after exercise (EX1), 3 h after exercise (EX2) and control. Animals from the exercising groups swam until exhaustion, with an initial workload of 2% of body mass attached to the tail. Control mice did not perform any exercise but were kept immersed in water for 20 min. Maximum swimming led to reactive oxygen species (ROS) generation in skeletal muscle, as indicated by increased thiobarbituric acid reactive species (TBARS) levels (4062.67 ±1487.10 vs 19,072.48 ± 8738.16 nmol malondialdehyde (MDA)/mg protein, control vs EX1). Exercise also promoted NF-κB activation in soleus muscle. Cytokine secretion following exercise was marked by increased plasma interleukin-6 (IL-6) levels 3 h post-exercise (P < 0.05). Interleukin-10 (IL-10) levels were reduced following exercise and remained reduced 3 h post-exercise (P < 0.05). Plasma levels of other cytokines investigated, monocyte chemotactic protein-1 (MCP-1), tumor necrosis factor-alpha (TNF-α), interferon-gamma (IFN-γ) and interleukin-12 (IL-12), were not altered by exercise. The present findings showed that maximum swimming, as well as other exercise models, led to lipid peroxidation and NF-κB activation in skeletal muscle and increased plasma IL-6 levels. The plasma cytokine response was also marked by reduced IL-10 levels. These results were attributed to exercise type and intensity.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.