Vasorelaxant effects of the potassium channel opener SR 47063 on the isolated human saphenous vein and rat aorta

The vasorelaxant effects of SR 47063 (4-(2-cyanimino-1,2-dihydropyrid-1-yl)-2,2-dimethyl-6-nitrochromene), a new K+-channel opener structurally related to levcromakalim, were examined in isolated human saphenous vein (HSV) and rat aorta (RA). HSV or RA rings were precontracted with either KCl or noradrenaline and cumulative relaxant concentration-response curves were obtained for SR 47063 (0.1 nM to 1 µM) in the presence or absence of 3 µM glibenclamide. SR 47063 potently relaxed HSV and RA precontracted with 20 mM (but not 60 mM) KCl or 10 µM noradrenaline in a concentration-dependent manner, showing slightly greater activity in the aorta. The potency of the effect of SR 47063 on HSV and RA was 12- and 58-fold greater, respectively, than that reported for the structurally related K+-channel opener levcromakalim. The vasorelaxant action of SR 47063 in both blood vessels was strongly inhibited by 3 µM glibenclamide, consistent with a mechanism of action involving ATP-dependent K+-channels.

Conditions and practices in the commercialisation of innovations in wood industry

The report 'Conditions and practices in the commercialisation of innovation in wood industry' has been written as a part of the Wood Academy project. The report analyses the commercialisation conditions and practices of wood industry by utilising product categorisation based on a conceptual schema which combines the aspects of the transfer of the procession of utility and the degree of form/service utility (or value-added) created or provided by the company. Open innovation approaches help to perceive the possible new product and service innovations as well as the new business models and earning logics in the industry. The report also contains brief company cases to demonstrate theory-to-practice and showcase company examples from successful Finnish companies.

Measuring higher order optical aberrations of the human eye: techniques and applications

In the present paper we discuss the development of "wave-front", an instrument for determining the lower and higher optical aberrations of the human eye. We also discuss the advantages that such instrumentation and techniques might bring to the ophthalmology professional of the 21st century. By shining a small light spot on the retina of subjects and observing the light that is reflected back from within the eye, we are able to quantitatively determine the amount of lower order aberrations (astigmatism, myopia, hyperopia) and higher order aberrations (coma, spherical aberration, etc.). We have measured artificial eyes with calibrated ametropia ranging from +5 to -5 D, with and without 2 D astigmatism with axis at 45º and 90º. We used a device known as the Hartmann-Shack (HS) sensor, originally developed for measuring the optical aberrations of optical instruments and general refracting surfaces in astronomical telescopes. The HS sensor sends information to a computer software for decomposition of wave-front aberrations into a set of Zernike polynomials. These polynomials have special mathematical properties and are more suitable in this case than the traditional Seidel polynomials. We have demonstrated that this technique is more precise than conventional autorefraction, with a root mean square error (RMSE) of less than 0.1 µm for a 4-mm diameter pupil. In terms of dioptric power this represents an RMSE error of less than 0.04 D and 5º for the axis. This precision is sufficient for customized corneal ablations, among other applications.

Human papillomavirus infection and p53 protein expression in vulvar intraepithelial neoplasia and invasive squamous cell carcinoma

The etiopathogenesis of vulvar intraepithelial neoplasia (VIN III) and invasive squamous cell carcinoma are largely unknown. Since there are few studies on Brazilian patients, our purpose was to determine the frequency of human papillomavirus (HPV) infection and the expression of p53 in these lesions, and associate them with other factors such as age, morphological subtypes, multicentric and multifocal disease. Thirty-eight cases of VIN III, nine of superficially invasive carcinoma, and 55 of invasive vulvar carcinoma were retrospectively evaluated from 1983 to 1995 for the presence of HPV by immunohistochemistry and in situ hybridization, and for p53 protein expression by immunohistochemistry on paraffin sections. All cases for whom material (slides and paraffin blocks) and clinical data were available were included. HPV and p53 were detected in 57.9 and 21.1% of the VIN III lesions, 33.3 and 66.7% of superficially invasive carcinomas, and 7.3 and 58.2% of invasive squamous cell carcinomas, respectively. HPV infection was associated with younger age in the VIN III and invasive carcinoma groups. In the latter, HPV infection was associated with the basaloid variant. p53 expression rate was higher in superficially invasive and invasive lesions and was not related to HPV infection. Our findings are similar to others and support the hypothesis that there are two separate entities of the disease, one associated with HPV and the other unrelated, with p53 inactivation possibly being implicated in some of the cases.

Response of the growth plate of uremic rats to human growth hormone and corticosteroids

Children with chronic renal failure in general present growth retardation that is aggravated by corticosteroids. We describe here the effects of methylprednisolone (MP) and recombinant human growth hormone (rhGH) on the growth plate (GP) of uremic rats. Uremia was induced by subtotal nephrectomy in 30-day-old rats, followed by 20 IU kg-1 day-1 rhGH (N = 7) or 3 mg kg-1 day-1 MP (N = 7) or 20 IU kg-1 day-1 rhGH + 3 mg kg-1 day-1 MP (N = 7) treatment for 10 days. Control rats with intact renal function were sham-operated and treated with 3 mg kg-1 day-1 MP (N = 7) or vehicle (N = 7). Uremic rats (N = 7) were used as untreated control animals. Structural alterations in the GP and the expression of anti-proliferating cell nuclear antigen (PCNA) and anti-insulin-like growth factor I (IGF-I) by epiphyseal chondrocytes were evaluated. Uremic MP rats displayed a reduction in the proliferative zone height (59.08 ± 4.54 vs 68.07 ± 7.5 µm, P < 0.05) and modifications in the microarchitecture of the GP. MP and uremia had an additive inhibitory effect on the proliferative activity of GP chondrocytes, lowering the expression of PCNA (19.48 ± 11.13 vs 68.64 ± 7.9% in control, P < 0.0005) and IGF-I (58.53 ± 0.96 vs 84.78 ± 2.93% in control, P < 0.0001), that was counteracted by rhGH. These findings suggest that in uremic rats rhGH therapy improves longitudinal growth by increasing IGF-I synthesis in the GP and by stimulating chondrocyte proliferation.

Human papillomavirus infection and its association with cervical dysplasia in Ecuadorian women attending a private cancer screening clinic

Women living in Latin American countries bear a disproportionate burden of cervical cancer, a condition caused by infection with the human papillomavirus (HPV). We performed a study in Santa Elena, Guayas (currently Santa Elena Province), Ecuador, to determine how often HPV could be detected in women attending a private cancer screening clinic. Participants underwent a Pap test, and vaginal and cervical swabs were performed for HPV testing by the polymerase chain reaction (PCR). Each participant completed a verbally administered survey. The mean age of 302 participants was 37.7 years (range 18 to 78 years). The majority of cervical and vaginal specimens contained sufficient DNA to perform PCR. Overall, 24.2% of the participants had either a cervical or vaginal swab that tested positive for HPV. In general, there was a good correlation between the HPV types detected in the cervical and vaginal swabs from the participants, but vaginal swabs were more likely to contain HPV DNA than were cervical swabs. The high-risk HPV types 16, 52, 58, and 59 and the low-risk HPV types 62, 71, 72, and 83 were the most frequently detected HPV types. The number of lifetime sexual partners was positively associated with detection of any HPV type, detection of oncogenic HPV, and abnormal Pap smears. Further studies are needed to determine if these results are representative of all Ecuadorian women and to determine if cervical cancers in Ecuadorian women are caused by the same HPV types found in the swab specimens obtained in this study.

Human papillomavirus detection and p16 methylation pattern in a case of esophageal papilloma

Esophageal cancer is a prevalent cancer worldwide. Some studies have reported the possible etiology of human papillomavirus (HPV) in benign and malignant papillomas of the esophagus but the conclusions are controversial. In the present study, we investigated an esophageal papilloma from a 30-year-old male patient presenting aphasia. HPV DNA was detected by generic PCR using MY09/11 primers, and restriction fragment length polymorphism revealed the presence of HPV54, usually associated with benign genital lesions. Hypermethylation of the pINK4A gene was also investigated due to its relation to malignant transformation, but no modification was detected in the host gene. Except for an incipient reflux, no risk factors such as cigarette smoking, alcohol abuse or an infected sexual partner were recorded. Since esophageal lesions may have a malignant potential, HPV detection and typing are useful tools for patient follow-up.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

The Construction of ‘Disciplinary’ Violence Against Children — Social Workers’, Police Officers’ and Parents’ Rationales

This dissertation examines parental disciplinary violence against children in authority records and in the criminal procedure in Finland. The main aim is to analyze disciplinary violence, how it is defined, and how it is constructed as a crime by social workers, the police, and parents. This dissertation consists of four sub-studies and a summary article. In the first sub-study, I examine how disciplinary violence appears in child welfare documents and analyze the decision-making processes and measures taken by the child welfare workers. The second sub-study, utilizing police interview data, examines police officers’ perceptions of disciplinary violence, its criminalization, and its investigation. In addition to this analysis of police officers’ own perceptions, in the third sub-study, I use reports of crime and pre-trial investigation documents to look at what a typical suspicion of disciplinary violence coming to the attention of the police is and examine the decision-making processes of the police. Utilizing authority data, the fourth sub-study analyzes how parents rationalize the use of disciplinary violence to the authorities investigating these suspicions. The research provides findings that are unprecedented in Finland. Firstly, it was shown that social workers’ decision-making processes in suspicions of disciplinary violence follow three pathways of reasoning, with many factors taken into consideration; and in less than one-third of the cases, a request for criminal investigation has been made to the police. Secondly, it was verified that police officers hold different perceptions of disciplinary violence, and these perceptions have multiple effects on the investigation of these cases and the construction of disciplinary violence as a crime. Thirdly, the analysis of the reports of crime and pre-trial investigation documents showed that almost two-thirds of the cases of disciplinary violence had been sent to a prosecutor by the police and, thus, defined as a crime. However, in many cases, acts of disciplinary violence were often seen as ‘educational, petty one-off incidents’ and a possible trial and punishment for the perpetrator were seen as unreasonable. Fourthly, it was found that parents often try to neutralize and rationalize the violence they have used against their children, for example, either by denying the victim, the criminal intent, or the entire act, or relying on the necessity of the forbidden act. The dissertation concludes that disciplinary violence is defined and constructed in authority policies and practices, first and foremost, by the severity of the act, the nature of the act as continuous or singular, the perceived harm caused by the act to a child, and the perceptions of authorities regarding physical punishment of children. The asymmetrical power setting present in disciplinary violence and parents’ legitimized right to raise and discipline their children partly seem to explain why criminal-law processing of these suspicions of violence and understanding these as crimes is difficult. Finally, this research calls for more coherent and consistent authority practices and policies, achieved by educating authorities and increasing awareness on disciplinary violence, questions the need for a concept like ‘disciplinary’ violence, and suggests more emphasis on unambiguous perceptions of a child’s best interest.

National exchange rate policies and international debt crises: how Brazil did not follow Argentina into a default in 2001-2002

This paper examines how exchange rate policies and IMF Stand-By Arrangements affect debt crises using econometrics and a comparison between Argentina and Brazil. It refines an existing diagram outlining crisis development to propose crisis prevention strategies. Flexible exchange rate policies reduce a country's probability of default by over 4%, but Stand-By Arrangements increase it by an inconsequential percentage. Unlike Argentina, Brazil avoided a default via a freely-floating exchange rate system, fiscal deficit reduction, and a cooperative and coordinated relationship with the IMF. The results provide policymakers from developing countries with lessons to manage their countries' default risks more effectively.

Opening a can of worms : perceptions and practices of teachers in Newfoundland and Labrador incorporating the role of a therapist

Educational trends of inclusion and collaboration have led to changing roles of teachers, including an emphasis on personal support. To provide for social, emotional, and behavioural needs, teachers may adopt a therapeutic role. Many models for such support are proposed, with most models including the importance of student-teacher relationships, a focus on social, emotional, and behavioural development, and direct instruction of related skills. This study includes 20 interview participants. In addition, 4 of the 20 interview participants also took part in a case study. It examines whether participants adopt a therapeutic role, their beliefs about student-teacher relationships, whether they provide interventions in personal issues, and instructed social, emotional, and behaviour skills. Findings show that teachers adopt an academic role as well as a therapeutic role, believe student-teacher relationships are important, are approached about personal issues, and instruct social, emotional, and behavioural skills. Talking and listening are commonly used to provide support, typically exclusive of formal curricular goals. The challenges in providing front-line support issues that may be shared within an established student-teacher relationship are considered. Support in turn for teachers who choose to provide support for personal issues in the classroom within a therapeutic role are suggested, including recommendations for support and referral related to specific social, emotional, or behavioural scenarios that may arise in the school community.