856 resultados para Barrier Island


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The term urban heat island (UHI) refers to the common situation in which the city is warmer than its rural surroundings. In this dissertation, the local climate, and especially the UHI, of the coastal city of Turku (182,000 inh.), SW Finland, was studied in different spatial and temporal scales. The crucial aim was to sort out the urban, topographical and water body impact on temperatures at different seasons and times of the day. In addition, the impact of weather on spatiotemporal temperature differences was studied. The relative importance of environmental factors was estimated with different modelling approaches and a large number of explanatory variables with various spatial scales. The city centre is the warmest place in the Turku area. Temperature excess relative to the coldest sites, i.e. rural areas about 10 kilometers to the NE from the centre, is on average 2 °C. Occasionally, the UHI intensity can be even 10 °C. The UHI does not prevail continuously in the Turku area, but occasionally the city centre can be colder than its surroundings. Then the term urban cool island or urban cold island (UCI) is used. The UCI is most common in daytime in spring and in summer, whereas during winter the UHI prevails throughout the day. On average, the spatial temperature differences are largest in summer, whereas the single extreme values are often observed in winter. The seasonally varying sea temperature causes the shift of relatively warm areas towards the coast in autumn and inland in spring. In the long term, urban land use was concluded to be the most important factor causing spatial temperature differences in the Turku area. The impact was mainly a warming one. The impact of water bodies was emphasised in spring and autumn, when the water temperature was relatively cold and warm, respectively. The impact of topography was on average the weakest, and was seen mainly in proneness of relatively low-lying places for cold air drainage during night-time. During inversions, however, the impact of topography was emphasised, occasionally outperforming those of urban land use and water bodies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Kartta kuuluu A. E. Nordenskiöldin kokoelmaan

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The main objective of the study was to define the methodology for assessing the limits for application island grids instead of interconnecting with existing grid infrastructure. The model for simulation of grid extension distance and levelised cost of electricity has been developed and validated by the case study in Finland. Thereafter, sensitivities of the application limits were examined with the respect to operational environment, load conditions, supply security and geographical location. Finally, recommendations for the small-scale rural electrification projects in the market economy environment have been proposed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to assess the contamination of oysters (Crassostrea gigas), harvested in six different regions of the South Bay of Santa Catarina Island, with Coliforms at 45 ºC, Escherichia coli, Vibrio spp., positive coagulase staphylococci, and Salmonella sp. over a period of one year. One hundred eighty oyster samples were collected directly from their culture sites and analyzed. Each sample consisted of a pool of 12 oysters. All of the samples analyzed showed absence of Salmonella, 18 (10%) samples showed presence of Escherichia coli, 15 (8.3%) samples were positive for V. alginolyticus, and Vibriocholerae was detected in 4 samples (2.2%). The counts of positive-coagulase staphylococci varied from <10 to 1.9 x 102 CFU.g-1, whereas the counts of Coliforms at 45 ºC and E. coli ranged from <3 to 1.5 x 102 MPN.g-1 and <3 and 4.3 x 10 MPN.g-1, respectively. Counts of V. parahaemolyticus and V. vulnificus ranged between <3 and 7 MPN.g-1, for both microorganisms. This suggests the need for monitoring these Vibrios contamination in oysters. Based on the results of the microbiological assays, the samples analyzed showed acceptable bacteriological quality, i.e., they were within the parameters established by Brazilian Legislation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The increasing use of energy, food, and materials by the growing population in the world is leading to the situation where alternative solutions from renewable carbon resources are sought after. The growing use of plastics depends on the raw-oil production while oil refining are politically governed and required for the polymer manufacturing is not sustainable in terms of carbon footprint. The amount of packaging is also increasing. Packaging is not only utilising cardboard and paper, but also plastics. The synthetic petroleum-derived plastics and inner-coatings in food packaging can be substituted with polymeric material from the renewable resources. The trees in Finnish forests constitute a huge resource, which ought to be utilised more effectively than it is today. One underutilised component of the forests is the wood-derived hemicelluloses, although Spruce Oacetyl-galactoglucomannans (GGMs) have previously shown high potential for material applications and can be recovered in large scale. Hemicelluloses are hydrophilic in their native state, which restrains the use of them for food packaging as non-dry item. To cope with this challenge, we intended to make GGMs more hydrophobic or amphiphilic by chemical grafting and consequently with the focus of using them for barrier applications. Methods of esterification with anhydrides and cationic etherification with a trimethyl ammonium moiety were established. A method of controlled synthesis to obtain the desired properties by the means of altering temperature, reaction time, the quantity of the reagent, and even the solvent for purification of the products was developed. Numerous analytical tools, such as NMR, FTIR, SEC-MALLS/RI, MALDI-TOF-MS, RP-HPLC and polyelectrolyte titration were used to evaluate the products from different perspectives and to acquire parallel proofs of their chemical structure. Modified GGMs with different degree of substitution and the correlating level of hydrophobicity was applied as coatings on cartonboard and on nanofibrillated cellulose-GGM films to exhibit barrier functionality. The water dispersibility in processing was maintained with GGM esters with low DS. The use of chemically functionalised GGM was evaluated for the use as barriers against water, oxygen and grease for the food packaging purposes. The results show undoubtedly that GGM derivatives exhibit high potential to function as a barrier material in food packaging.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in power electronics technology have made it possible to develop competitive and reliable low-voltage DC (LVDC) distribution networks. Further, islanded microgrids—isolated small-scale localized distribution networks— have been proposed to reliably supply power using distributed generations. However, islanded operations face many issues such as power quality, voltage regulation, network stability, and protection. In this thesis, an energy management system (EMS) that ensures efficient energy and power balancing and voltage regulation has been proposed for an LVDC island network utilizing solar panels for electricity production and lead-acid batteries for energy storage. The EMS uses the master/slave method with robust communication infrastructure to control the production, storage, and loads. The logical basis for the EMS operations has been established by proposing functionalities of the network components as well as by defining appropriate operation modes that encompass all situations. During loss-of-powersupply periods, load prioritizations and disconnections are employed to maintain the power supply to at least some loads. The proposed EMS ensures optimal energy balance in the network. A sizing method based on discrete-event simulations has also been proposed to obtain reliable capacities of the photovoltaic array and battery. In addition, an algorithm to determine the number of hours of electric power supply that can be guaranteed to the customers at any given location has been developed. The successful performances of all the proposed algorithms have been demonstrated by simulations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Today, renewable energy technologies and modern power electronics have made it feasible to implement low voltage direct current (LVDC) microgrids (MGs) ca-pable to island operation. Such LVDC networks are particularly useful in remote areas. However, there are still pending issues in island operated LVDC MGs like electrical safety and controlled operation, which should be addressed before wide-scale implementation. This thesis is focused on the overall protection of an island operated LVDC network concept, including protection against electrical shocks, mains equipment protection and protection of photovoltaic (PV) power sources and battery energy storage systems (BESSs). The topic is approached through ex-amination of the safety hazards and the appropriate methods to protect against them, comprising considerations for earthing system selection and realisation of the protection system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this thesis is to find and analyze different methods which reduce fluid bed boilers’ auxiliary power consumption. The objective is to examine the effects and feasibility of these methods. The literature part explains how fluid bed boilers work and what are the main sources of auxiliary power consumption. Designs and operation of these equipment are presented. The literature part also discusses the basics of auxiliary power consumption reduction and introduces four low pressure drop constructions. The experimental part inspects six different methods. Effects of these methods on the auxiliary power consumption are calculated and their impacts on the operation of the boiler are modeled. Calculations show that reasonable changes can reduce fluid bed boiler’s auxiliary power consumption by 2,1-10,2 %. Biggest reductions come from lower air coefficients, smaller bed a-level pressures and lower primary/secondary air –ratios. Models showed no problems with the smaller bed a-level pressures. With the lower air coefficients and smaller primary/secondary air –ratios the models showed a significant increase in the carbon monoxide levels.