Enhanced emotional empathy after psychosocial stress in young healthy men

Empathy is a core prerequisite for human social behavior. Relatively, little is known about how empathy is influenced by social stress and its associated neuroendocrine alterations. The current study was designed to test the impact of acute stress on emotional and cognitive empathy. Healthy male participants were exposed to a psychosocial laboratory stressor (trier social stress test, (TSST)) or a well-matched control condition (Placebo-TSST). Afterwards they participated in an empathy test measuring emotional and cognitive empathy (multifaceted empathy test, (MET)). Stress exposure caused an increase in negative affect, a rise in salivary alpha amylase and a rise in cortisol. Participants exposed to stress reported more emotional empathy in response to pictures displaying both positive and negative emotional social scenes. Cognitive empathy (emotion recognition) in contrast did not differ between the stress and the control group. The current findings provide initial evidence for enhanced emotional empathy after acute psychosocial stress.

The Psychological Outcome of Religious Coping with Stressful Life Events in a Swiss Sample of Church Attendees

Background: Recent research suggested thatreligious coping, based on dispositional religiousness and spirituality (R/S), is an important modulating factor in the process of dealing with adversity. In contrast to the United States, the effect of R/S on psychological adjustment to stress is a widely unexplored area in Europe. Methods: We examined a Swiss sample of 328 church attendees in the aftermath of stressful life events to explore associations of positive or negative religious coping with the psychological outcome. Applying a cross-sectional design, we used Huber’s Centrality Scale to specify religiousness and Pargament’s measure of religious coping (RCOPE) for the assessment of positive and negative religious coping. Depressive symptoms and anxiety as outcome variables were examined by the Brief Symptom Inventory. The Stress-Related Growth Scale and the Marburg questionnaire for the assessment of well-being were used to assess positive outcome aspects. We conducted Mann-Whitney tests for group comparisons and cumulative logit analysis for the assessmentof associations of religious coping with our outcome variables. Results: Both forms of religious coping were positively associated with stress-related growth (p < 0.01). However, negative religious coping additionally reduced well-being (p = 0.05, β = 0.52, 95% CI = 0.27–0.99) and increased anxiety (p = 0.02, β = 1.94, 95% CI = 1.10–3.39) and depressive symptoms (p = 0.01, β = 2.27, 95% CI = 1.27–4.06). Conclusions: The effects of religious coping on the psychological adjustment to stressful life events seem relevant. These findings should be confirmed in prospective studies.

Predicting the onset of psychosis in patients at clinical high risk: practical guide to probabilistic prognostic reasoning

Prediction of psychosis in patients at clinical high risk (CHR) has become a mainstream focus of clinical and research interest worldwide. When using CHR instruments for clinical purposes, the predicted outcome is but only a probability; and, consequently, any therapeutic action following the assessment is based on probabilistic prognostic reasoning. Yet, probabilistic reasoning makes considerable demands on the clinicians. We provide here a scholarly practical guide summarising the key concepts to support clinicians with probabilistic prognostic reasoning in the CHR state. We review risk or cumulative incidence of psychosis in, person-time rate of psychosis, Kaplan-Meier estimates of psychosis risk, measures of prognostic accuracy, sensitivity and specificity in receiver operator characteristic curves, positive and negative predictive values, Bayes’ theorem, likelihood ratios, potentials and limits of real-life applications of prognostic probabilistic reasoning in the CHR state. Understanding basic measures used for prognostic probabilistic reasoning is a prerequisite for successfully implementing the early detection and prevention of psychosis in clinical practice. Future refinement of these measures for CHR patients may actually influence risk management, especially as regards initiating or withholding treatment.

Final Results of a Prospective Evaluation of the Predictive Value of Interim Positron Emission Tomography in Patients With Diffuse Large B-Cell Lymphoma Treated With R-CHOP-14 (SAKK 38/07)

PURPOSE Our main objective was to prospectively determine the prognostic value of [(18)F]fluorodeoxyglucose positron emission tomography/computed tomography (PET/CT) after two cycles of rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone given every 14 days (R-CHOP-14) under standardized treatment and PET evaluation criteria. PATIENTS AND METHODS Patients with any stage of diffuse large B-cell lymphoma were treated with six cycles of R-CHOP-14 followed by two cycles of rituximab. PET/CT examinations were performed at baseline, after two cycles (and after four cycles if the patient was PET-positive after two cycles), and at the end of treatment. PET/CT examinations were evaluated locally and by central review. The primary end point was event-free survival at 2 years (2-year EFS). RESULTS Median age of the 138 evaluable patients was 58.5 years with a WHO performance status of 0, 1, or 2 in 56%, 36%, or 8% of the patients, respectively. By local assessment, 83 PET/CT scans (60%) were reported as positive and 55 (40%) as negative after two cycles of R-CHOP-14. Two-year EFS was significantly shorter for PET-positive compared with PET-negative patients (48% v 74%; P = .004). Overall survival at 2 years was not significantly different, with 88% for PET-positive versus 91% for PET-negative patients (P = .46). By using central review and the Deauville criteria, 2-year EFS was 41% versus 76% (P < .001) for patients who had interim PET/CT scans after two cycles of R-CHOP-14 and 24% versus 72% (P < .001) for patients who had PET/CT scans at the end of treatment. CONCLUSION Our results confirmed that an interim PET/CT scan has limited prognostic value in patients with diffuse large B-cell lymphoma homogeneously treated with six cycles of R-CHOP-14 in a large prospective trial. At this point, interim PET/CT scanning is not ready for clinical use to guide treatment decisions in individual patients.

Ultra-low-dose dual-source CT coronary angiography with high pitch: diagnostic yield of a volumetric planning scan and effects on dose reduction and imaging strategy

OBJECTIVE To evaluate the role of an ultra-low-dose dual-source CT coronary angiography (CTCA) scan with high pitch for delimiting the range of the subsequent standard CTCA scan. METHODS 30 patients with an indication for CTCA were prospectively examined using a two-scan dual-source CTCA protocol (2.0 × 64.0 × 0.6 mm; pitch, 3.4; rotation time of 280 ms; 100 kV): Scan 1 was acquired with one-fifth of the tube current suggested by the automatic exposure control software [CareDose 4D™ (Siemens Healthcare, Erlangen, Germany) using 100 kV and 370 mAs as a reference] with the scan length from the tracheal bifurcation to the diaphragmatic border. Scan 2 was acquired with standard tube current extending with reduced scan length based on Scan 1. Nine central coronary artery segments were analysed qualitatively on both scans. RESULTS Scan 2 (105.1 ± 10.1 mm) was significantly shorter than Scan 1 (127.0 ± 8.7 mm). Image quality scores were significantly better for Scan 2. However, in 5 of 6 (83%) patients with stenotic coronary artery disease, a stenosis was already detected in Scan 1 and in 13 of 24 (54%) patients with non-stenotic coronary arteries, a stenosis was already excluded by Scan 1. Using Scan 2 as reference, the positive- and negative-predictive value of Scan 1 was 83% (5 of 6 patients) and 100% (13 of 13 patients), respectively. CONCLUSION An ultra-low-dose CTCA planning scan enables a reliable scan length reduction of the following standard CTCA scan and allows for correct diagnosis in a substantial proportion of patients. ADVANCES IN KNOWLEDGE Further dose reductions are possible owing to a change in the individual patient's imaging strategy as a prior ultra-low-dose CTCA scan may already rule out the presence of a stenosis or may lead to a direct transferal to an invasive catheter procedure.

Towards an Earlier Diagnosis of Primary Ciliary Dyskinesia: Which Patients Should Undergo Detailed Diagnostic Testing?

Primary ciliary dyskinesia is a rare heterogeneous recessive genetic disorder of motile cilia, leading to chronic upper and lower respiratory symptoms. Prevalence is estimated at around 1:10,000, but many patients remain undiagnosed, while others receive the label incorrectly. Proper diagnosis is complicated by the fact that the key symptoms such as wet cough, chronic rhinitis and recurrent upper and lower respiratory infection, are common and nonspecific. There is no single gold standard test to diagnose PCD. Presently, the diagnosis is made by augmenting the medical history and physical examination with in patients with a compatible medical history following a demanding combination of tests including nasal nitric oxide, high- speed video microscopy, transmission electron microscopy, genetics, and ciliary culture. These tests are costly and need sophisticated equipment and experienced staff, restricting use to highly specialised centers. Therefore, it would be desirable to have a screening test for identifying those patients who should undergo detailed diagnostic testing. Three recent studies focused on potential screening tools: one paper assessed the validity of nasal nitric oxide for screening, and two studies developed new symptom-based screening tools. These simple tools are welcome, and hopefully remind physicians whom to refer for definitive testing. However, they have been developed in tertiary care settings, where 10 to 50% of tested patients have PCD. Sensitivity and specificity of the tools are reasonable, but positive and negative predictive values may be poor in primary or secondary care settings. While these studies take an important step forward towards an earlier diagnosis of PCD, more remains to be done before we have tools tailored to different health care settings.

The Relationship Among Resilience, Forgiveness, and Anger Expression in Adolescents

This study was designed to investigate and describe the relationship among resilience, forgiveness and anger expression in adolescents. The purpose of the study was to explore whether certain adolescent resiliencies significantly related to positive or negative affective, behavioral, or cognitive levels of forgiveness and certain types of anger expression in adolescents. This study also investigated whether there were certain adolescent resiliencies and types of forgiveness that can predict lower levels of negative anger expression in adolescents. This research was built on two conceptual models: Wolin and Wolin's (1993) Challenge Model and the Forgiveness Process Model (Enright & Human Development Study Group, 1991). It was based on a quantitative, single-subject correlational research design. A multiple regression analysis was also used to explore possible effects of resilience and forgiveness on anger expression in adolescents. In addition, two demographic variables, Age and Gender, were examined for possible effects on anger expression. Data were gathered from a convenience sample sample of 70 students in three Maine public high schools using three separate assessment instruments: the Adolescent Resiliency Attitudes Scale (ARAS), the Adolescent Version of the Enright Forgiveness Inventory (EFI), and the Adolescent Anger Rating Scale (AARS). Correlational analyses were done on the scales and subscales of these surveys. Significant relationships were found between several adolescent resiliencies and forms of forgiveness as well as between some adolescent resiliencies and types of anger expression. The data indicated that Total Resiliency significantly correlated with Total Forgiveness as well as Total Anger. The findings also identified particular adolescent resiliencies that significantly predicted types of anger expression, while forgiveness did not predict types of anger expression. The data revealed that Age and Gender had no significant affect on anger expression. These findings suggest that the constructs of adolescent resilience and forgiveness have commonalities that can influence how adolescents express anger, and further suggest that intervention and prevention programs expand their focus to incorporate forgiveness skills. The findings from this study can provide critical information to counselors, therapists, and other helping professionals working with adolescents, on approaches to designing and implementing therapy modalities or developmental school guidance programs for adolescents.

The Acceleration of Stock Options in Anticipation of FAS 123 (R)

The Financial Accounting Standards Board (FASB) mandated the expensing of stock options with FAS 123 (R). As of March 2006, 749 companies had accelerated the vesting of their employee stock options and avoided a reduction in their reported profits that otherwise would have occurred under the new standard. There are many different motives for the acceleration strategy, and the focus of this study is to determine whether shareholders viewed these motives as either positive or negative. A favorable return subsequent to an acceleration announcement would signify that shareholder's viewed management's motives as positive. An unfavorable return subsequent to an acceleration announcement would signify that shareholder's viewed management's motives as negative. The evidence from this study suggests that shareholders reacted favorably, on average, to acceleration announcements. However, these results lack statistical significance and are based on a small sample, thus, they should be interpreted with caution.

Zoning and the built environment: A public health analysis of zoning in Austin, Texas

The built environment is part of the physical environment made by people and for people. Because the built environment is such a ubiquitous component of the environment, it acts as an important pathway in determining health outcomes. Zoning, a type of urban planning policy, is one of the most important mechanisms connecting the built environment to public health. This policy analysis research paper explores how zoning regulations in Austin, Texas promote or prohibit the development of a healthy built environment. A systematic literature review was obtained from Active Living Research, which contained literature published about the relationships between the built environment, physical activity, and health. The results of these studies identified the following four components of the built environment that were associated to health: access to recreational facilities, sprawl and residential density, land use mix, and sidewalks and their walkability. A hierarchy analysis was then performed to demonstrate the association between these aspects of the built environment and health outcomes such as obesity, cardiovascular disease, and general health. Once these associations had been established, the components of the built environment were adapted into the evaluation criteria used to conduct a public health analysis of Austin's zoning ordinance. A total of eighty-eight regulations were identified to be related to these components and their varying associations to human health. Eight regulations were projected to have a negative association to health, three would have both a positive and negative association simultaneously, and nine were indeterminable with the information obtained through the literature review. The remaining sixty-eight regulations were projected to be associated in a beneficial manner to human health. Therefore, it was concluded that Austin's zoning ordinance would have an overwhelmingly positive impact on the public's health based on identified associations between the built environment and health outcomes.^

Sex, drugs, and STIs: Syphilis infection and hepatitis B vaccine compliance among illicit drug users in Houston

Although the association between syphilis infection status and compliance with the hepatitis B virus vaccine has been the focus of investigation, there is a lack of data regarding the association between syphilis infection and HBV vaccine compliance. The author investigated the association between the exposure of syphilis infection and the outcome of HBV vaccine completion, defined as degree of constancy and accuracy with which a patient follows a prescribed regimen. A cohort design was employed using interview and serological data from the Drugs, AIDS, STDs, Hepatitis (DASH) Research Project; analysis was restricted to HIV and HBV seronegative (at baseline), illicit drug users residing in Harris County. Syphilis negative and syphilis positive infection status was determined from the serological data while covariates and outcome information were determined from the DASH Project Questionnaire; enrolled subjects (n=1160) were selected from the data. Association between exposure and outcome was assessed with logistic regression adjusted for data-based confounders. ^ A prevalence of 7% and 71% was found for syphilis and HBV vaccine compliance, respectively. When measuring the actual association between syphilis infection status and HBV vaccine compliance, an odds ratio of 1.49 (95% CI: 0.86, 2.72) was obtained. There was a non-significant association between these two variables. 78% of the study population was syphilis positive and completed the vaccine series compared to 70% of the population that was syphilis negative and received all three doses. This finding confirms that there is a difference between syphilis positive and negative drug users with respect to HBV vaccine compliance. The fact that differences were found in these drug users with respect to vaccine schedule supports the idea that sub-group differences may exist and thus merits further investigation. If these differences are confirmed, it is recommended that STI interventions identify community characteristics of their samples and target populations based on practices specific to that community. ^

A screening for anti-West Nile immunoglobulin-G and immunoglobulin-M in the Cameron County Hispanic cohort

This study is designed to be a cross-sectional, retrospective analysis of the seroprevalence of anti-WNV antibodies in 1,006 plasma samples collected from February 2, 2006 to June 18, 2007 originally for The Cameron County Hispanic Cohort: Extreme obesity and uncontrolled diabetes on the U.S.-Mexico border, major concerns for populations with health disparities. The aim of this thesis research is to give a more up-to-date picture of Flavivirus activity in south Texas, which can potentially contribute to the surveillance objective of arboviral control in this area. A West Nile virus (WNV) seroprevalence study in humans in this particular area has never before been completed. Plasma samples were tested using immunoglobulin-G (IgG) and immunoglobulin-M (IgM) WNV enzyme linked immunosorbent assays (ELISA). Estimated seroprevalence for this particular population was 0.98% or 9.8 cases of West Nile disease per 1,000 citizens. After IgG testing, seroprevalence in the study population was found to be 15.4%. Specimens tested for WNV IgG were compared with a subset of specimens (N=803) tested for history of primary dengue virus (DENV) infection. Of the 803 specimens tested for IgG to DENV, 308 were positive. Of the 132 positive WNV IgG specimens in the subset, 131 (99.2%) tested also tested positive for DENV IgG. It would be helpful to use standard plaque reduction neutralization testing to determine if the seroprevalence is in fact lower because of cross-reaction to DENV on testing. Regardless of the possibility of other Flavivirus activity occurring prior to the introduction of WNV into the United States and the potential for cross-reactivity, Texas has ranked in the top 5 states with the highest, laboratory confirmed incidence of infection with WNV since 2003. Indicating that climate factors and the presence of suitable vectors makes Texas a hotspot for WNV activity. ^ A description of the study population by age, gender, and income was done indicating a statistically significant income difference with a mean household income per year being $13,413.55 for a case and $20,268.80 for non-cases (p=0.001). Lower income neighborhoods should be targeted for education and prevention of vector-borne diseases during the summer months in Cameron County. With respect to gender, being male has been noted in the literature to be a risk factor for infection with WNV (25). In this study, females comprised approximately 68% of the study population, they also made up 66.5% of the positive IgG specimens. An odds ratio of 0.91 indicates that women are less likely to be IgG positive for WNV as compared to men; however, this was not found to be significant based on the 95% confidence interval, but is consistent with the literature. When looking at age difference between positive and negative/equivocal cases, there was no statistical difference found between the two groups. ^ We concluded that this study will enable us to understand the epidemiology of WNV transmission since its introduction into the United States and hopefully to maintain or improve the current measures we have in place to prevent infections that are seen annually with WNV.^

Attitudes About Predictive MEN1 Genetic Testing in Minors

Multiple Endocrine Neoplasia type 1 (MEN1) is a hereditary cancer syndrome characterized by tumors of the endocrine system. Tumors most commonly develop in the parathyroid glands, pituitary gland, and the gastro-entero pancreatic tract. MEN1 is a highly penetrant condition and age of onset is variable. Most patients are diagnosed in early adulthood; however, rare cases of MEN1 present in early childhood. Expert consensus opinion is that predictive genetic testing should be offered at age 5 years, however there are no evidence-based studies that clearly establish that predictive genetic testing at this age would be beneficial since most symptoms do not present until later in life. This study was designed to explore attitudes about the most appropriate age for predictive genetic testing from individuals at risk of having a child with MEN1. Participants who had an MEN1 mutation were invited to complete a survey and were asked to invite their spouses to participate as well. The survey included several validated measures designed to assess participants’ attitudes about predictive testing in minors. Fifty-eight affected participants and twenty-two spouses/partners completed the survey. Most participants felt that MEN1 genetic testing was appropriate in healthy minors. Younger age and increased knowledge of MEN1 genetics and inheritance predicted genetic testing at a younger age. Additionally, participants who saw more positive than negative general outcomes from genetic testing were more likely to favor genetic testing at younger ages. Overall, participants felt genetic testing should be offered at a younger age than most adult onset conditions and most felt the appropriate time for testing was when a child could understand and participate in the testing process. Psychological concerns seemed to be the primary focus of participants who favored later ages for genetic testing, while medical benefits were more commonly cited for younger age. This exploratory study has implications for counseling patients whose children are at risk of developing MEN1 and illustrates issues that are important to patients and their spouses when considering testing in children.

DETERMINING THE GENOTYPE-PHENOTYPE CONNECTION IN SYNTHETIC INDUCIBLE GENE EXPRESSION SYSTEMS

Introduction Gene expression is an important process whereby the genotype controls an individual cell’s phenotype. However, even genetically identical cells display a variety of phenotypes, which may be attributed to differences in their environment. Yet, even after controlling for these two factors, individual phenotypes still diverge due to noisy gene expression. Synthetic gene expression systems allow investigators to isolate, control, and measure the effects of noise on cell phenotypes. I used mathematical and computational methods to design, study, and predict the behavior of synthetic gene expression systems in S. cerevisiae, which were affected by noise. Methods I created probabilistic biochemical reaction models from known behaviors of the tetR and rtTA genes, gene products, and their gene architectures. I then simplified these models to account for essential behaviors of gene expression systems. Finally, I used these models to predict behaviors of modified gene expression systems, which were experimentally verified. Results Cell growth, which is often ignored when formulating chemical kinetics models, was essential for understanding gene expression behavior. Models incorporating growth effects were used to explain unexpected reductions in gene expression noise, design a set of gene expression systems with “linear” dose-responses, and quantify the speed with which cells explored their fitness landscapes due to noisy gene expression. Conclusions Models incorporating noisy gene expression and cell division were necessary to design, understand, and predict the behaviors of synthetic gene expression systems. The methods and models developed here will allow investigators to more efficiently design new gene expression systems, and infer gene expression properties of TetR based systems.

Indeterminate QunatiFERON-TB Gold In-Tube assay results in association with procedural specimen collection in children

BACKGROUND. The development of interferon-gamma release assays (IGRA) has introduced powerful tools in diagnosing latent tuberculosis infection (LTBI) and may play a critical role in the future of tuberculosis diagnosis. However, there have been reports of high indeterminate results in young patient populations (0-18 years). This study investigated results of the QunatiFERON-TB Gold In-Tube (QFT-GIT) IGRA in a population of children (0-18 years) at Texas Children's Hospital in association with specimen collection procedures using surrogate variables. ^ METHODS. A retrospective case-control study design was used for this investigation. Cases were defined as having QFT-GIT indeterminate results. Controls were defined as having either positive or negative results (determinates). Patients' admission status, staff performing specimen collection, and specific nurse performing specimen collection were used as surrogates to measure specimen collection procedures. ^ To minimize potential confounding, abstraction of patients' electronic medical records was performed. Abstracted data included patients' medications and evaluation at the time of QFT-GIT specimen collection in addition to their medical history. QFT-GIT related data was also abstracted. Cases and controls were characterized using chi-squared tests or Fisher's exact tests across categorical variables. Continuous variables were analyzed using one-way ANOVA and t-tests for continuous variables. A multivariate model was constructed by backward stepwise removal of statistically significant variables from univariate analysis. ^ RESULTS. Patient data was abstracted from 182 individuals aged 0-18 years from July 2010 to August 2011 at Texas Children's Hospital. 56 cases (indeterminates) and 126 controls (determinates) were enrolled. Cancer was found to be an effect modifier with subsequent stratification resulting in a cancer patient population too small to analyze (n=13). Subsequent analyses excluded these patients. ^ The exclusion of cancer patients resulted in a population of 169 patients with 49 indeterminates (28.99%) and 120 determinates (71.01%), with mean ages of 9.73 (95% CI: 8.03, 11.43) years and 11.66 (95% CI: 10.75, 12.56) years (p = 0.033), respectively. Median age of patients who were indeterminates and determinates were 12.37 and 12.87 years, respectively. Lack of data for our specific nurse surrogate (QFTNurse) resulted in its exclusion from analysis. The final model included only our remaining surrogate variables (QFTStaff and QFTInpatientOutpatient). The staff collecting surrogate (QFTStaff) was found to be modestly associated with indeterminates when nurses collected the specimen (OR = 1.54, 95% CI: 0.51, 4.64, p = 0.439) in the final model. Inpatients were found to have a strong and statistically significant association with indeterminates (OR = 11.65, 95% CI: 3.89, 34.9, p < 0.001) in the final model. ^ CONCLUSION. Inpatient status was used as a surrogate for indication of nurse drawn blood specimens. Nurses have had little to no training regarding shaking of tubes versus phlebotomists regarding QFT-GIT testing procedures. This was also measured by two other surrogates; specifically a medical note stating whether a nurse or phlebotomist collected the specimen (QFTStaff) and the name and title of the specific nurse if collection was performed by a nurse (QFTNurse). Results indicated that inpatient status was a strong and statistically significant factor for indeterminates, however, nurse collected specimens and indeterminate results had no statistically significant association in non-cancer patients. The lack of data denoting the specific nurse performing specimen collection excluded the QFTNurse surrogate in our analysis. ^ Findings suggests training of staff personnel in specimen procedures may have little effect on the number of indeterminates while inpatient status and thus possibly illness severity may be the most important factor for indeterminate results in this population. The lack of congruence between our surrogate measures may imply that our inpatient surrogate gauged illness severity rather than collection procedures as intended. ^ Despite the lack of clear findings, our analysis indicated that more than half of indeterminates were found in specimens drawn by nurses and as such staff training may be explored. Future studies may explore methods in measuring modifiable variables during pre-analytical QFT-GIT procedures that can be discerned and controlled. Identification of such measures may provide insight into ways to lowering indeterminate QFT-GIT rates in children.^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^