Thallium pi-cation complexation by calix[4]tubes: Tl-205 NMR and X-ray evidence

Thallium cation complexation by calix[4]tubes has been investigated by a combination of (TI)-T-205, H-1 NMR and ES MS demonstrating the solution formation of a dithallium complex in which the cations are held in the calix[4]arene cavities. In addition, the structure of the complex has been determined in the solid state revealing the cations to be held exclusively by pi-cation interactions. Furthermore, this crystal structure has been used as the basis for molecular dynamics simulations to confirm that binding of the smaller K+ cation in the calix[4]tube cryptand like array occurs via the axial route featuring a g-cation intermediate.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Metal complexes with atropisomeric sulfur ligands in asymmetric hydroformylation X-ray structure of [Rh2(μ-biphes)(cod)2] (H2biphes = 4,4′-biphenanthrene-3,3′-dithiol)

The addition of the atropisomeric racemic sulfur compound 4,4′-biphenanthrene-3,3′-dithiol (H2 biphes) to a dichloromethane solution of [{M(μ-OMe)(cod)}2] (M = Rh, Ir, cod = cycloocta-1,5-diene) afforded the dithiolate-bridged complexes [{Rh2(μ-biphes)(cod)2}n] (n = 2 5 or n = 1 6) and [{Ir2(μ-biphes)(cod)2}n]·nCH2Cl27. When 1,1′-binaphthalene-2,2′-dithiol (H2 binas) reacted with [{Ir(μ-OMe)(cod)}2], complex [Ir2(μ-binas)(cod)2] 8 was obtained. Complexes 5 and 6 reacted with carbon monoxide to give the dinuclear tetracarbonyl complex [Rh2(μ-biphes)(CO)4] 9. The reaction of 9 with PR3 provided the mixed-ligand complexes [{Rh2(μ-biphes)(CO)2(PR3)2}2] · xCH2Cl2 (R = Ph, x = 2 10, C6H11, x = 1 11) and [{Rh2(μ-biphes)(CO)3(PR3)}2] · CH2Cl212 (R = OC6H4But-o). The crystal structure of 6 was determined by X-ray diffraction. Reaction of the dithioether ligand Me2biphes with [Rh(cod)2]ClO4 in CH2Cl2 solution afforded the cationic complex [Rh(cod)(Me2biphes)]ClO4 · CH2Cl213. Asymmetric hydroformylation of styrene was performed using the complexes described. The extent of aldehyde conversion ranges from 53 to 100%, with selectivities towards branched aldehydes in the range 51 to 96%. The enantioselectivities were quite low and did not exceed 20%.

Diastereoselective formation of 2-aryl-3-arenesulfonyl 4-ethyl-1,3-oxazolidines: an X-ray crystallographic and 1H NMR study

N-Arylsulfonamides of (R)- and (S)-2-amino-1-butanol, on condensation with aromatic aldehydes produced diastereomerically pure 2-aryl-3-arenesulfonyl 4-ethyl-1,3-oxazolidines. The absolute configurations of one enantiomeric pair have been determined from two fully refined X-ray structures, supplemented by nmr data.

Reactions of methylvinyl and phenylvinyl ketones with a tricyclic ketone derived from 2-tetralone: characterization of crystalline products by X-ray diffraction

Base catalysed reaction of the tricyclic ketone (6 ⇌ 7) with methylvinyl ketone gave the tetracyclic ketols, 11, 13, 15, 16, and the pentacyclic ketols, 12, 17. With phenylvinyl ketone, the tetracyclic ketol (18) was formed. The stereostructures of the ketols were identified by X-Ray diffraction. The base-catalysed title reactions gave the cyclic ketols and derived compounds shown below whose structures were identified by X-ray diffraction.

Penciclovir solubility in Eudragit films: a comparison of X-ray, thermal, microscopic and release rate techniques

The solubility of penciclovir (C10N5O3H17) in a novel film formulation designed for the treatment of cold sores was determined using X-ray, thermal, microscopic and release rate techniques. Solubilities of 0.15–0.23, 0.44, 0.53 and 0.42% (w/w) resulted for each procedure. Linear calibration lines were achieved for experimentally and theoretically determined differential scanning calorimetry (DSC) and X-ray powder diffractometry (XRPD) data. Intra- and inter-batch data precision values were determined; intra values were more precise. Microscopy was additionally useful for examining crystal shape, size distribution and homogeneity of drug distribution within the film. Whereas DSC also determined melting point, XRPD identified polymorphs and release data provided relevant kinetics.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

Control and analysis of oriented thin films of lipid inverse bicontinuous cubic phases using grazing incidence small-angle X‑ray scattering

Lipid cubic phases are complex nanostructures that form naturally in a variety of biological systems, with applications including drug delivery and nanotemplating. Most X-ray scattering studies on lipid cubic phases have used unoriented polydomain samples as either bulk gels or suspensions of micrometer-sized cubosomes. We present a method of investigating cubic phases in a new form, as supported thin films that can be analyzed using grazing incidence small-angle X-ray scattering (GISAXS). We present GISAXS data on three lipid systems: phytantriol and two grades of monoolein (research and industrial). The use of thin films brings a number of advantages. First, the samples exhibit a high degree of uniaxial orientation about the substrate normal. Second, the new morphology allows precise control of the substrate mesophase geometry and lattice parameter using a controlled temperature and humidity environment, and we demonstrate the controllable formation of oriented diamond and gyroid inverse bicontinuous cubic along with lamellar phases. Finally, the thin film morphology allows the induction of reversible phase transitions between these mesophase structures by changes in humidity on subminute time scales, and we present timeresolved GISAXS data monitoring these transformations.

Study of the phenanthroline-Mn-imidazole bonding in Mn(I) triscarbonyl complex: A X-ray and DFT computational analysis

355 nm light irradiation of fac-[Mn(CO)(3)(phen)(imH)](+) (fac-1) produces the mer-1 isomer and a long lived radical which can be efficiently trapped by electron acceptor molecules. EPR experiments shows that when excited, the manganese(I) complex can be readily oxidized by one-electron process to produce Mn(II) and phen(.-). In the present study, DFT calculations have been used to investigated the photochemical isomerization of the parent Mn(I) complex and to characterize the electronic structures of the long lived radical. The theoretical calculations have been performed on both the fac-1 and mer-1 species as well as on their one electron oxidized species fac-1+ and mer-1+ for the lowest spin configurations (S = 1/2) and fac-6 and mer-6 (S = 5/2) for the highest one to characterize these complexes. In particular, we used a charge decomposition analysis (CDA) and a natural bonding orbital (NBO) to have a better understanding of the chemical bonding in terms of the nature of electronic interactions. The observed variations in geometry and bond energies with an increasing oxidation state in the central metal ion are interpreted in terms of changes in the nature of metal-ligand bonding interactions. The X-ray structure of fac-1 is also described. (C) 2011 Elsevier B.V. All rights reserved.

New Ni(II)-sulfonamide complexes: Synthesis, structural characterization and antibacterial properties. X-ray diffraction of [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)]

The synthesis, structural characterization, voltammetric experiments and antibacterial activity of [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] were studied and compared with similar previously reported copper complexes. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O crystallized in a monoclinic system, space group C2/c where the nickel ion was in a slightly distorted octahedral environment, coordinated with two sulfisoxazole molecules through the heterocyclic nitrogen and four water molecules. [Ni(sulfapyridine)(2)] crystallized in a orthorhombic crystal system, space group Pnab. The nickel ion was in a distorted octahedral environment, coordinated by two aryl amine N from two sulfonamides acting as monodentate ligands and four N atoms (two sulfonamidic N and two heterocyclic N) from two different sulfonamide molecules acting as bidentate ligands. Differential pulse voltammograms were recorded showing irreversible peaks at 1040 and 1070 mV, respectively, attributed to Ni(II)/Ni(III) process. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] presented different antibacterial behavior against Staphylococcus aureus and Escherichia coli from the similar copper complexes and they were inactive against Mycobacterium tuberculosis. (c) 2007 Elsevier Inc. All rights reserved.

Antimycobacterial and antitumor activities of Palladium(II) complexes containing isonicotinamide (isn): X-ray structure of trans-[Pd(N(3))(2)(isn)(2)]

Complexes of the type trans-[PdX(2)(isn)(2)] {X = Cl (1), N(3) (2), SCN (3), NCO (4); isn = isonicotinamide} were synthesized and evaluated for in vitro antimycobacterial and antitumor activities. The coordination mode of the isonicotinamide and the pseudohalide ligands was inferred by IR spectroscopy. Single crystal X-ray diffraction determination on 2 showed that coordination geometry around Pd(II) is nearly square planar, with the ligands in a trans configuration. All the compounds demonstrated better in vitro activity against Mycobacterium tuberculosis than isonicotinamide and pyrazinamide. Among the complexes, compound 2 was found to be the most active with MIC of 35.89 mu M. Complexes 1-4 were also screened for their in vitro antitumor activity towards LM3 and LP07 murine cancer cell lines. (C) 2010 Elsevier Masson SAS. All rights reserved.

Molecular Basis of the Thermostability and Thermophilicity of Laminarinases: X-ray Structure of the Hyperthermostable Laminarinase from Rhodothermus marinus and Molecular Dynamics Simulations

Glycosyl hydrolases are enzymes capable of breaking the glycosidic linkage of polysaccharides and have considerable industrial and biotechnological applications. Driven by the later applications, it is frequently desirable that glycosyl hydrolases display stability and activity under extreme environment conditions, such as high temperatures and extreme pHs. Here, we present X-ray structure of the hyperthermophilic laminarinase from Rhodothermus marinus (RmLamR) determined at 1.95 angstrom resolution and molecular dynamics simulation studies aimed to comprehend the molecular basis, for the thermal stability of this class of enzymes. As most thermostable proteins, RmLamR contains a relatively large number of salt bridges, which are not randomly distributed on the structure. On the contrary, they form clusters interconnecting beta-sheets of the catalytic domain. Not all salt bridges, however, are beneficial for the protein thermostability: the existence of charge-charge interactions permeating the hydrophobic core of the enzymes actually contributes to destabilize the structure by facilitating water penetration into hydrophobic cavities, as can be seen in the case of mesophilic enzymes. Furthermore, we demonstrate that the mobility of the side-chains is perturbed differently in each class of enzymes. The side-chains of loop residues surrounding the catalytic cleft in the mesophilic laminarinase gain mobility and obstruct the active site at high temperature. By contrast, thermophilic laminarinases preserve their active site flexibility, and the active-site cleft remains accessible for recognition of polysaccharide substrates even at high temperatures. The present results provide structural insights into the role played by salt-bridges and active site flexibility on protein thermal stability and may be relevant for other classes of proteins, particularly glycosyl hydrolases.

A combined X-ray and theoretical study of flavonoid compounds with anti-inflammatory activity

The structure of 7,4`-dimethoxy-3`-acetylflavone (tithonin-Ac) has been determined by X-ray diffraction and its geometry is compared with optimized geometrical parameters obtained by means of density functional theory at the B3LYP/6-311++G(d,p) level of calculation. in addition, vertical ionization potential (IPv) and acidity for tithonin-Ac and two derivatives have been also calculated. Calculations of spin densities were also performed for the radical formed by the electron abstraction of other flavones. The unpaired electron is located on C3 carbon atom (21-25%). (C) 2008 Elsevier B.V. All rights reserved.

Antimycobacterial and antitumor activities of Palladium(II) complexes containing isonicotinamide (isn): X-ray structure of trans-[Pd(N-3)(2)(isn)(2)]

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Preliminary X-ray crystallographic studies of BthTX-II, a myotoxic Asp49-phospholipase A(2) with low catalytic activity from Bothrops jararacussu venom

For the first time, a complete X-ray diffraction data set has been collected from a myotoxic Asp49-phospholipase A(2) (Asp49-PLA(2)) with low catalytic activity (BthTX-II from Bothrops jararacussu venom) and a molecular-replacement solution has been obtained with a dimer in the asymmetric unit. The quaternary structure of BthTX-II resembles the myotoxin Asp49-PLA(2) PrTX-III (piratoxin III from B. pirajai venom) and all non-catalytic and myotoxic dimeric Lys49-PLA(2)s. In contrast, the oligomeric structure of BthTX-II is different from the highly catalytic and non-myotoxic BthA-I (acidic PLA(2) from B. jararacussu). Thus, comparison between these structures should add insight into the catalytic and myotoxic activities of bothropic PLA(2)s.