Revealing Assembly of a Pore-Forming Complex Using Single-Cell Kinetic Analysis and Modeling

Many biological processes depend on the sequential assembly of protein complexes. However, studying the kinetics of such processes by direct methods is often not feasible. As an important class of such protein complexes, pore-forming toxins start their journey as soluble monomeric proteins, and oligomerize into transmembrane complexes to eventually form pores in the target cell membrane. Here, we monitored pore formation kinetics for the well-characterized bacterial pore-forming toxin aerolysin in single cells in real time to determine the lag times leading to the formation of the first functional pores per cell. Probabilistic modeling of these lag times revealed that one slow and seven equally fast rate-limiting reactions best explain the overall pore formation kinetics. The model predicted that monomer activation is the rate-limiting step for the entire pore formation process. We hypothesized that this could be through release of a propeptide and indeed found that peptide removal abolished these steps. This study illustrates how stochasticity in the kinetics of a complex process can be exploited to identify rate-limiting mechanisms underlying multistep biomolecular assembly pathways.

In Vitro and In Vivo Effects of the Bumped Kinase Inhibitor 1294 in the Related Cyst-Forming Apicomplexans Toxoplasma gondii and Neospora caninum.

We report on the in vitro effects of the bumped kinase inhibitor 1294 (BKI-1294) in cultures of virulent Neospora caninum isolates Nc-Liverpool (Nc-Liv) and Nc-Spain7 and in two strains of Toxoplasma gondii (RH and ME49), all grown in human foreskin fibroblasts. In these parasites, BKI-1294 acted with 50% inhibitory concentrations (IC50s) ranging from 20 nM (T. gondii RH) to 360 nM (N. caninum Nc-Liv), and exposure of intracellular stages to 1294 led to the nondisjunction of newly formed tachyzoites, resulting in the formation of multinucleated complexes similar to complexes previously observed in BKI-1294-treated N. caninum beta-galactosidase-expressing parasites. However, such complexes were not seen in a transgenic T. gondii strain that expressed CDPK1 harboring a mutation (G to M) in the gatekeeper residue. In T. gondii ME49 and N. caninum Nc-Liv, exposure of cultures to BKI-1294 resulted in the elevated expression of mRNA coding for the bradyzoite marker BAG1. Unlike in bradyzoites, SAG1 expression was not repressed. Immunofluorescence also showed that these multinucleated complexes expressed SAG1 and BAG1 and the monoclonal antibody CC2, which binds to a yet unidentified bradyzoite antigen, also exhibited increased labeling. In a pregnant mouse model, BKI-1294 efficiently inhibited vertical transmission in BALB/c mice experimentally infected with one of the two virulent isolates Nc-Liv or Nc-Spain7, demonstrating proof of concept that this compound protected offspring from vertical transmission and disease. The observed deregulated antigen expression effect may enhance the immune response during BKI-1294 therapy and will be the subject of future studies.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

G -rich oligodeoxyribonucleotides: Triplexes and transcription

Formation of a triple helix resulting from oligonucleotide binding to the DNA double helix offers new possibilities to control gene expression at the transcriptional level. Purine-motif triplexes can be formed under physiological pH. Nevertheless, this formation was inhibited by certain monovalent cations during the association but not during dissociation. Since triplexes are very stable, it was possible to assemble them in the absence of KCl and have them survive throughout the course of an in vitro transcription reaction. As for the design of a better triplex-forming oligonucleotide, 12 nucleotides in length afforded the highest binding affinity. G/T-rich oligonucleotides can be very polymorphic in solution. The conditions for forming purine-motif triplexes, duplexes or G-quartets were determined. Understanding these parameters will be important for the practical use of G-rich oligonucleotides in the development of DNA aptamers where the structure of the oligonucleotide is paramount in dictating its function. Finally, purine-motif triplexes were demonstrated to significantly inhibit gene transcription in vitro. The optimal effect on this process was dependent on the location of triplexes within the promoter, i.e., whether upstream or proximally downstream of the transcription start site. The mechanism for the inhibition of transcription appeared to be interference with initiation through preventing engagement by RNA polymerase. This finding is revolutionary when compared to the conventional model where triplexes inhibit transcription only by occluding binding by trans-acting proteins. Our findings broaden the utility of triplexes and support a strategy for antigene therapy by triplexes. ^