Exogenous normal lymph reduces liver injury induced by lipopolysaccharides in rats

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Estrutura dos grânulos de amido de milho normal e ceroso

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.

Estabilidade de géis de amido de milho normal, ceroso e com alto teor de amilose adicionados de gomas guar e xantana durante os processos de congelamento e descongelamento

O objetivo do presente trabalho foi estudar os efeitos das gomas guar e xantana sobre a estabilidade dos géis de amido de milho normal, ceroso e com alto teor de amilose submetidos aos processos de congelamento e descongelamento. Os géis desses amidos, com concentração total de sólidos de 10% e adicionados das gomas (0,15; 0,50; 0,85 e 1%), foram submetidos a 5 ciclos de congelamento (20 horas a -18 °C) e descongelamento (4 horas a 25 °C), com exceção dos géis com alto teor de amilose, que foram submetidos a apenas 1 ciclo, devido à perda da estrutura de gel. A determinação da sinérese (porcentagem de água liberada) foi realizada pela diferença entre a massa inicial e a massa final das amostras. O gel de amido de milho normal liberou 74,45% de água, sendo que a adição de 1% da goma xantana reduziu significativamente a sinérese para 66,43%. A adição de 0,85 e 1% da goma xantana também reduziu a sinérese dos géis de amido ceroso. O menor teor de sinérese foi obtido com a utilização de 1% de goma xantana ao gel de amido de milho com alto teor de amilose, evidenciando a ação crioprotetora desta goma.

Características qualitativas de produtos elaborados com carne de frango pálida e normal

Foram elaborados hambúrgueres e filés empanados com peitos de frango pálidos e normais e foram realizadas as seguintes análises de qualidade: cor, Perda de Peso por Cozimento (PPC), cisalhamento, Encolhimento por Fritura (EF), TBA, avaliação microbiológica e sensorial para os hambúrgueres, e TBA, análise microbiológica e análise sensorial para os filés empanados. As amostras de hambúrgueres elaboradas não diferiram significativamente (p > 0,05) nos parâmetros de coloração, EF, PPC e análise microbiológica e sensorial. Para análise de força de cisalhamento, houve diferença significativa (p < 0,05) entre os hambúrgueres no período de 7, 60 e 120 dias, sendo que os hambúrgueres elaborados com carne pálida (1,92; 1,31 e 1,46, respectivamente) apresentaram as menores médias quando comparados com os de carne normal (2,34; 1,85 e 1,73, respectivamente). Na análise de TBA, as amostras elaboradas com carne pálida também tiveram os maiores resultados com 90 a 180 dias de estocagem (5,28; 7,78; 8,89; 5,02) quando comparadas às de carne normal (2,62; 7,05; 8,08; 3,89). Para os filés empanados, não foram encontradas diferenças significativas (p > 0,05) entre a elaboração com carne de coloração normal e pálida para os parâmetros avaliados. Estes resultados demonstram que a carne pálida pode ser utilizada para a elaboração de produtos industrializados sem causar prejuízos em sua qualidade.

Caracterização físico-química, reológica, morfológica e térmica dos amidos de milho normal, ceroso e com alto teor de amilose

O objetivo do presente estudo foi avaliar os amidos de milho normal, ceroso e com alto teor de amilose, fabricados pela National Starch, por meio da determinação das suas características físico-químicas, morfológicas, térmicas e reológicas. O amido de milho com alto teor de amilose (AM) apresentou teor de amilose igual a 71%, sendo que os valores obtidos para o amido de milho normal (M) e o amido de milho ceroso (AP) foram de 27,8 e 1,8%, respectivamente. Traços de proteína e lipídios foram encontrados nas amostras. O amido de milho ceroso apresentou maior viscosidade máxima e uma menor tendência à retrogradação, se comparado ao amido de milho normal. O amido AP apresentou menor entalpia de gelatinização, como pode ser observado nas análises de calorimetria exploratória diferencial (DSC), na qual a temperatura de gelatinização foi de 75 °C e o ΔH de 3,34 J.g-1, e também na análise de RVA (Rapid Visco Analyser), em que a temperatura de pasta foi de 71 °C. Apresentando, dessa forma, valores inferiores aos verificados para os outros amidos. O valor do ΔH de retrogradação do amido AP, mostrou-se 25,8% inferior ao ΔH do amido M. O amido AM apresentou o valor de 26,38 J.g-1, demonstrando o maior envolvimento da molécula de amilose no processo de retrogradação. Isso também foi evidenciado pela medida da força dos géis: o gel de AM apresentou força 99,18% superior, retrogradando mais que os outros amidos. As análises de difração de raio X mostraram que os amidos de milho normal e ceroso apresentaram um padrão de difração do tipo A e o amido de milho com alto teor de amilose apresentou padrão do tipo B.

Retenção de aroma na secagem em atmosferas normal e modificada: desenvolvimento do sistema de estudo

Na secagem de determinados alimentos, como frutas, juntamente com a água há também a evaporação de outras substâncias voláteis presentes em quantidades menores. Por isso, torna-se interessante considerar nos estudos de secagem a evaporação, além da água, desses outros componentes voláteis. A modificação da atmosfera tem sido utilizada em armazenamento, principalmente de vegetais, mas pode também ser estendida à secagem, pois pode influenciar a perda de voláteis responsáveis pelas características sensoriais do produto final. No presente trabalho, é apresentado um sistema de secagem previamente desenvolvido, no qual a atmosfera de secagem pode ser modificada pela adição de gases ou líquidos. Desenvolveu-se um sistema-modelo a partir da composição química básica do abacaxi e da adição de outros compostos, contendo um dos principais componentes do aroma desta fruta (hexanoato de etila). Além disso, também foi desenvolvida a metodologia analítica de determinação do aroma no sistema-modelo e no abacaxi, a partir dos estudos de extração de aromas e de análise cromatográfica gasosa. O aroma presente no sistema-modelo foi extraído em hexano e os componentes voláteis do aroma do abacaxi foram extraídos em éter etílico

Ministère de la Guerre. Direction du Génie. Bureau du personnel. Instruction du 31 décembre 1919 pour l'admission à l'Ecole polytechnique en 1920 (concours normal). Additif du 31 janvier 1920 à l'instruction du 31 décembre 1919 pour l'admission à l'Ecole polytechnique en 1920 (concours normal). Instruction du 31 décembre 1919 pour l'admission à l'Ecole polytechnique en 1920 (concours spécial)

[Ecole polytechnique]

The normal co-ordinate analysis, vibrational spectra and theoretical infrared intensities of some thiocarbonyl halide molecules /

TITLE: The normal co-ordinate analysis, vibrational spectra and theoretical infrared intensities of some thiocarbonyl halides. AUTHOR: J. L. Brema SUPERVISOR: Dr. D. C. Moule NUMBER OF PAGES: 89 ABSTRACT: The vibrational assignment of the five-in-plane fundamental modes of CSClBr has been made on the basis of infrared gas phase and liquid Raman spectral analyses to supplement our earlier vibrational studies. Even though the one out-of-plane fundamental was not observed spectroscopically an attempt has been made to predict its frequency. The vibrational spectra contained impurity bands and the CSClBr assignment was made only after a thorough analysis of the impurities themselves. A normal co-ordinate analysis calculation was performed assuming a Urey-Bradley force field. This calculation yielded the fundamental frequencies in good agreement with those observed after refinement of the originally transferred force constants. The theoretical frequencies are the eigenvalues of the secular equation and the calculation also gave the corresponding eigenvectors in the form of the very important LLj matrix. The [l] matrix is the transfoirmation between internal co-ordinates and normal co-ordinates and it is essential for Franck-Condon calculations on electronically excited molecules and for infrared Integrated band intensity studies. Using a self-consistent molecular orbital calculation termed "complete neglect of differential overlap" (CNDO/2) , theoretical values of equilibrium bond lengths and angleswere calcuted for a series of carbonyl and thlocarbonyl molecules. From these calculations valence force field force constants were also determined but with limited success. With the CNIX)/2 method theoretical dipole moment derivatives with respect to symmetrized internal co-ordinates were calculated and the results should be useful in a correlation with experimentally determined values.

Secretory immunity in overweight and obese versus normal-weight early-and late-pubertal females

Obesity is a condition associated with a wide variety of health problems including hypertension, dyslipidemia, diabetes mellitus, certain forms of cancer, cardiovascular disease, and gallstones (157). TTiere is growing evidence that obesity may also be related to compromised immune function due to altered metabolic, psychological, and physical attributes (93). The aim of this study was to compare: a) immunity-related variables such as frequency of upper respiratory tract infections (URTI) and salivary secretory immunoglobulin A (sIgA) levels between overweight/obese (OB) and normal weight (NW) early-pubertal and late-pubertal girls, and b) stress-related variables such as Cortisol, melatonin, the melatonin/cortisol ratio, testosterone and the testosterone/cortisol ratio. Physical activity levels, stress indicators, and fatigue were used to explain potential differences in the dependent variables. It was hypothesized that the OB females would have lower melatonin (M) and higher Cortisol (C) and testosterone (T) levels compared with NW girls, regardless of maturity status. The altered levels of melatonin, Cortisol, and testosterone, would result in decreased M/C and T/C ratios, despite the increase in testosterone in OB females. It was hypothesized that this altered hormonal status results in a compromised immunity marked by higher frequency of upper respiratory tract infections (URTI) and decreased levels of secretory immunoglobulin A (sIgA). It was also hypothesized that OB girls would participate in less hours of physical activity than their NW counterparts and that this would relate to their stress and immunity levels. Forty (16 early- and 24 late-pubertal) overweight and obese females were compared to fifty-three (27 eariy- and 26 late-pubertal) age-matched normal-weight control subjects. Participants were categorized as early-pubertal (EP) or late-pubertal (LP) using Tanner self-staging of secondary sex characteristics. Subjects were classified into the two adiposity groups according to relative body fat (%BF), where normal weight (NW) subjects had a %BF less than 25%, and overweight and obese (OB) subjects had a %BF greater than 27.5%. Participants completed a number of questionnaires and information was collected on menstrual history, smoking history, alcohol and caffeine consumption, and medical history. Following the determination of maturity status, a complete anthropometric assessment was made including height, body mass, and body composition. All questionnaires and measurements were completed during a one-hour visit between 1 500 and 1900 hours Relative body fat was assessed using bioelectrical impedance analysis. Resting saliva samples were obtained and assayed (ELISA) for testosterone, Cortisol, melatonin and secretory immunoglobulin A. Physical activity was self-reported using the Godin- Shephard Leisure time questionnaire, and quantified using Actigraph GTIM accelerometers, which participants wore for seven consecutive days from the time they woke up in the morning, until the time they went to bed. Late-pubertal girls also completed questionnaires on their perceived stress and fatigue. Finally, all participants also filled out a one-month health log to record frequency of symptoms of upper respiratory tract infections (URTI). Significant age effects were found for testosterone, Cortisol, incidence of sickness, and sIgA when controlling for physical activity, however there were no significant effects of adiposity on any of the variables. There was a trend which neared-significance for an effect of adiposity on sIgA (p=0.01). There were no significant differences between the groups on the total selfreported leisure-time physical activity in METs per week, however EP girls recorded significantly greater levels of moderate, hard, and very hard physical activity from accelerometers. Results of the perceived stress and fatigue questionnaires in late-pubertal girls demonstrated that contrary to what was hypothesized, NW girls reported more stress and more fatigue than OB girls. Results of the present study suggest that excess adiposity in early- and latepubescent girls may not have a negative impact on immunity as hypothesized.

A comparison of electrophysiological changes during the sleep onset period of psychophysiological insomniacs, psychiatric insomniacs and normal sleepers

The EEG of the sleep onset period of psychophysiological insomniacs, psychiatric insomniacs and controls was compared using power spectral analysis (FFT). Eighteen drug-free subjects were equally divided into three groups according to their responses in the Brock Sleep and Insomnia Questionnaire, the Minnesota Multiphasic Personality Inventory and the Sleep Disorders Questionnaire. Group 1 consisted of psychophysiological insomniacs, group 2 included insomniacs with an indication of psychiatric disturbances, and group 3 was a control group. EEG, EOG and EMG were recorded for two consecutive nights. Power spectral analysis (FFT) of EEG at C4 from the sleep onset period (defined as lights out to the first five minutes of stage 2) was performed on all standard frequency bands, delta: .5-4 Hz; theta: 4-8 Hz; alpha: 8-12 Hz; sigma: 12-15 Hz beta: 15-25 Hz. Psychophysiological insomniacs had less alpha during wakefulness than the other two groups and did not show the dramatic drop in alpha across the sleep onset period, which characterizes normal sleep. They also had less delta, especially during stage 2 on night 2. They also showed less delta in the last quartile of the chronological analysis of the sleep onset period. Psychiatric insomniacs showed lower relative beta power values overall while psychophysiological insomniacs showed higher relative beta power values during wakefulness. This microanalysis 11 confirms that the sleep onset period is generally similar for psychiatric insomniacs and normal sleepers. This may be due to the sample of psychiatric insomniacs being heterogeneous or may reflect a sleep onset system that is essentially intact. Psychophysiological insomniacs have higher cortical arousal during the sleep onset period than do the psychiatric insomniacs and the controls. Clear differences in the sleep onset period of psychophysiological insomniacs exist. The dramatic changes in power values in these two groups are not seen in the psychophysiological insomniacs, which may make the discrimination between wakefulness and sleep more difficult.