A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Association of a polynuclear iron-sulfur center with a mutant FNR protein enhances DNA binding.

In the facultative anaerobe Escherichia coli, the transcription factor FNR (fumarate nitrate reduction) regulates gene expression in response to oxygen deprivation. To investigate how the activity of FNR is regulated by oxygen availability, two mutant proteins, DA154 and LH28-DA154, which have enhanced in vivo activity in the presence of oxygen, were purified and compared. Unlike other previously examined FNR preparations, the absorption spectrum of LH28-DA154 had two maxima at 324 nm and 419 nm, typical of iron-sulfur (Fe-S)-containing proteins. Consistent with these data, metal analysis showed that only the LH28-DA154 protein contained a significant amount of iron and acid-labile sulfide, and, by low temperature EPR spectroscopy, a signal typical of a [3Fe-4S]+ cluster was detected. The LH28-DA154 protein that contained the Fe-S cluster also contained a higher proportion of dimers and had a 3- to 4-fold higher apparent affinity for the target DNA than the DA154 protein. In agreement with this, we found that when the LH28-DA154 protein was treated with an iron chelator (alpha,alpha'-dipyridyl), it lost its characteristic absorption and the apparent affinity for DNA was reduced 6-fold. However, increased DNA binding and the characteristic absorption spectrum could be restored by in vitro reconstitution of the Fe-S center. DNA binding of the LH28-DA154 protein was also affected by the redox state of the Fe-S center, since protein exposed to oxygen bound 1/10th as much DNA as the protein reduced anaerobically with dithionite. The observation that DNA binding is enhanced when the Fe-S center is reduced indicates that the redox state of the Fe-S center affects the DNA-binding activity of this protein and suggests a possible mechanism for regulation of the wild-type protein.

The Menkes/Wilson disease gene homologue in yeast provides copper to a ceruloplasmin-like oxidase required for iron uptake.

The CCC2 gene of the yeast Saccharomyces cerevisiae is homologous to the human genes defective in Wilson disease and Menkes disease. A biochemical hallmark of these diseases is a deficiency of copper in ceruloplasmin and other copper proteins found in extracytosolic compartments. Here we demonstrate that disruption of the yeast CCC2 gene results in defects in respiration and iron uptake. These defects could be reversed by supplementing cells with copper, suggesting that CCC2 mutant cells were copper deficient. However, cytosolic copper levels and copper uptake were normal. Instead, CCC2 mutant cells lacked a copper-dependent oxidase activity associated with the extracytosolic domain of the FET3-encoded protein, a ceruloplasmin homologue previously shown to be necessary for high-affinity iron uptake in yeast. Copper restored oxidase activity both in vitro and in vivo, paralleling the ability of copper to restore respiration and iron uptake. These results suggest that the CCC2-encoded protein is required for the export of copper from the cytosol into an extracytosolic compartment, supporting the proposal that intracellular copper transport is impaired in Wilson disease and Menkes disease.

Transient Activation of Meox1 Is an Early Component of the Gene Regulatory Network Downstream of Hoxa2

Hox genes encode transcription factors that regulate morphogenesis in all animals with bilateral symmetry. Although Hox genes have been extensively studied, their molecular function is not clear in vertebrates, and only a limited number of genes regulated by Hox transcription factors have been identified. Hoxa2 is required for correct development of the second branchial arch, its major domain of expression. We now show that Meox1 is genetically downstream from Hoxa2 and is a direct target. Meox1 expression is downregulated in the second arch of Hoxa2 mouse mutant embryos. In chromatin immunoprecipitation (ChIP), Hoxa2 binds to the Meox1 proximal promoter. Two highly conserved binding sites contained in this sequence are required for Hoxa2-dependent activation of the Meox1 promoter. Remarkably, in the absence of Meox1 and its close homolog Meox2, the second branchial arch develops abnormally and two of the three skeletal elements patterned by Hoxa2 are malformed. Finally, we show that Meox1 can specifically bind the DNA sequences recognized by Hoxa2 on its functional target genes. These results provide new insight into the Hoxa2 regulatory network that controls branchial arch identity.

Duodenal expression of iron transport molecules in untreated haemochromatosis subjects

Background and aims: In HFE associated hereditary haemochromatosis, the duodenal enterocyte behaves as if iron deficient and previous reports have shown increased duodenal expression of divalent metal transporter 1 (DMT1) and iron regulated gene 1 (Ireg1) in affected subjects. In those studies, many patients had undergone venesection, which is a potent stimulus of iron absorption. Our study investigated duodenal expression of DMT1 ( IRE and non-IRE), Ireg1, hephaestin, and duodenal cytochrome-b (Dyctb) in untreated C282Y homozygous haemochromatosis patients, iron deficient patients, and iron replete subjects. Methods: Total RNA was extracted from duodenal biopsies and expression of the iron transport genes was assessed by ribonuclease protection assay. Results: Expression of DMT1 ( IRE) and Ireg1 was increased 3 - 5-fold in iron deficient subjects compared with iron replete subjects. Duodenal expression of DMT1 ( IRE) and Ireg1 was similar in haemochromatosis patients and iron replete subjects but in haemochromatosis patients with elevated serum ferritin concentrations, both DMT1 ( IRE) and Ireg1 expression were inappropriately increased relative to serum ferritin concentration. Hephaestin and Dcytb levels were not upregulated in haemochromatosis. DMT1 ( IRE) and Ireg1 levels showed significant inverse correlations with serum ferritin concentration in each group of patients. Conclusions: These findings are consistent with DMT1 ( IRE) and Ireg1 playing primary roles in the adaptive response to iron deficiency. Untreated haemochromatosis patients showed inappropriate increases in DMT1 ( IRE) and Ireg1 expression for a given level of serum ferritin concentration, although the actual level of expression of these iron transport genes was not significantly different from that of normal subjects.

Effect of periodontal treatment on the serum antibody levels to heat shock proteins

We have shown previously that both humoral and cellular immune responses to heat shock protein 60 (HSP60) are elevated in chronic periodontitis patients compared with non-diseased subjects. The aim of the present study was to determine whether periodontal treatment could influence the level of serum antibodies to human HSP60 and Porphyromonas gingivalis GroEL, a bacterial homologue of human HSP60. Sera were obtained from 21 patients with moderate to advanced chronic periodontitis at the baseline examination and again after completion of treatment. Antibody levels were determined using an enzyme-linked immunosorbent assay. The mean anti-P. gingivalis GroEL antibody levels were down-regulated significantly by periodontal treatment when recombinant P. gingivalis GroEL was used as an antigen, whereas antibody levels to P. gingivalis GroEL-specific peptide were significantly elevated following successful periodontal therapy. The mean level of anti-human HSP60 antibody remained unchanged although individual levels of antibody either increased or decreased after periodontal treatment, suggesting that synthesis of these antibodies might be regulated independently during the course of periodontal infection. Although their regulatory mechanisms in chronic infection are not understood, further study would provide insight not only into the role of these antibodies in the pathogenesis of periodontitis but also into the possible link between periodontitis and systemic diseases such as coronary heart disease.

Inhibition of interferon signaling by the New York 99 strain and Kunjin subtype of West Nile virus involves blockage of STAT1 and STAT2 activation by nonstructural proteins

The interferon (IFN) response is the first line of defense against viral infections, and the majority of viruses have developed different strategies to counteract IFN responses in order to ensure their survival in an infected host. In this study, the abilities to inhibit IFN signaling of two closely related West Nile viruses, the New York 99 strain (NY99) and Kunjin virus (KUN), strain MRM61C, were analyzed using reporter plasmid assays, as well as immunofluorescence and Western blot analyses. We have demonstrated that infections with both NY99 and KUN, as well as transient or stable transfections with their replicon RNAs, inhibited the signaling of both alpha/beta IFN (IFN-alpha/beta) and gamma IFN (IFN-gamma) by blocking the phosphorylation of STAT1 and its translocation to the nucleus. In addition, the phosphorylation of STAT2 and its translocation to the nucleus were also blocked by KUN, NY99, and their replicons in response to treatment with IFN-alpha. IFN-alpha signaling and STAT2 translocation to the nucleus was inhibited when the KUN nonstructural proteins NS2A, NS2B, NS3, NS4A, and NS4B, but not NS1 and NS5, were expressed individually from the pcDNA3 vector. The results clearly demonstrate that both NY99 and KUN inhibit IFN signaling by preventing STAT1 and STAT2 phosphorylation and identify nonstructural proteins. responsible for this inhibition.

Identification of two evolutionarily conserved and functional regulatory elements in intron 2 of the human BRCA1 gene

Cross-species comparative genomics is a powerful strategy for identifying functional regulatory elements within noncoding DNA. In this paper, comparative analysis of human and mouse intronic sequences in the breast cancer susceptibility gene (BRCA1) revealed two evolutionarily conserved noncoding sequences (CNS) in intron 2, 5 kb downstream of the core BRCA1 promoter. The functionality of these elements was examined using homologous-recombination-based mutagenesis of reporter gene-tagged cosmids incorporating these regions and flanking sequences from the BRCA1 locus. This showed that CNS-1 and CNS-2 have differential transcriptional regulatory activity in epithelial cell lines. Mutation of CNS-1 significantly reduced reporter gene expression to 30% of control levels. Conversely mutation of CNS-2 increased expression to 200% of control levels. Regulation is at the level of transcription and shows promoter specificity. Both elements also specifically bind nuclear proteins in vitro. These studies demonstrate that the combination of comparative genomics and functional analysis is a successful strategy to identify novel regulatory elements and provide the first direct evidence that conserved noncoding sequences in BRCA1 regulate gene expression. (c) 2005 Elsevier Inc. All rights reserved.

Systemic regulation of intestinal iron absorption

The intestinal absorption of the essential trace element iron and its mobilization from storage sites in the body are controlled by systemic signals that reflect tissue iron requirements. Recent advances have indicated that the liver-derived peptide hepcidin plays a central role in this process by repressing iron release from intestinal enterocytes, macrophages and other body cells. When iron requirements are increased, hepcidin levels decline and more iron enters the plasma. It has been proposed that the level of circulating diferric transferrin, which reflects tissue iron levels, acts as a signal to alter hepcidin expression. In the liver, the proteins HFE, transferrin receptor 2 and hemojuvelin may be involved in mediating this signal as disruption of each of these molecules decreases hepcidin expression. Patients carrying mutations in these molecules or in hepcidin itself develop systemic iron loading (or hemochromatosis) due to their inability to down regulate iron absorption. Hepcidin is also responsible for the decreased plasma iron or hypoferremia that accompanies inflammation and various chronic diseases as its expression is stimulated by pro-inflammatory cytokines such as interleukin 6. The mechanisms underlying the regulation of hepcidin expression and how it acts on cells to control iron release are key areas of ongoing research.

The prion protein gene: Identifying regulatory signals using marsupial sequence

The function of the prion protein gene (PRNP) and its normal product PrPC is elusive. We used comparative genomics as a strategy to understand the normal function of PRNP. As the reliability of comparisons increases with the number of species and increased evolutionary distance, we isolated and sequenced a 66.5 kb BAC containing the PRNP gene from a distantly related mammal, the model Australian marsupial Macropus eugenii (tammar wallaby). Marsupials are separated from eutherians such as human and mouse by roughly 180 million years of independent evolution. We found that tammar PRNP, like human PRNP, has two exons. Prion proteins encoded by the tammar wallaby and a distantly related marsupial, Monodelphis domestica (Brazilian opossum) PRNP contain proximal PrP repeats with a distinct, marsupial-specific composition and a variable number. Comparisons of tammar wallaby PRNP with PRNPs from human, mouse, bovine and ovine allowed us to identify non-coding gene regions conserved across the marsupial-eutherian evolutionary distance, which are candidates for regulatory regions. In the PRNP 3' UTR we found a conserved signal for nuclear-specific polyadenylation and the putative cytoplasmic polyadenylation element (CPE), indicating that post-transcriptional control of PRNP mRNA activity is important. Phylogenetic footprinting revealed conserved potential binding sites for the MZF-1 transcription factor in both upstream promoter and intron/intron 1, and for the MEF2, MyTI, Oct-1 and NFAT transcription factors in the intron(s). The presence of a conserved NFAT-binding site and CPE indicates involvement of PrPC in signal transduction and synaptic plasticity. (c) 2004 Elsevier B.V. All rights reserved.

Small regulatory RNAs in mammals

Mammalian cells harbor numerous small non-protein-coding RNAs, including small nucleolar RNAs (snoRNAs), microRNAs (miRNAs), short interfering RNAs (siRNAs) and small double-stranded RNAs, which regulate gene expression at many levels including chromatin architecture, RNA editing, RNA stability, translation, and quite possibly transcription and splicing. These RNAs are processed by multistep pathways from the introns and exons of longer primary transcripts, including protein-coding transcripts. Most show distinctive temporal- and tissue-specific expression patterns in different tissues, including embryonal stem cells and the brain, and some are imprinted. Small RNAs control a wide range of developmental and physiological pathways in animals, including hematopoietic differentiation, adipocyte differentiation and insulin secretion in mammals, and have been shown to be perturbed in cancer and other diseases. The extent of transcription of non-coding sequences and the abundance of small RNAs suggests the existence of an extensive regulatory network on the basis of RNA signaling which may underpin the development and much of the phenotypic variation in mammals and other complex organisms and which may have different genetic signatures from sequences encoding proteins.

New insights into the interactions of serum proteins with bis(maltolato)oxovanadium(IV): Transport and biotransformation of insulin-enhancing vanadium pharmaceuticals

Significant new insights into the interactions of the potent insulin-enhancing compound bis(maltolato)oxovanadium(IV) (BMOV) with the serum proteins, apo-transferrin and albumin, are presented. Identical reaction products are observed by electron paramagnetic resonance (EPR) with either BMOV or vanadyl sulfate (VOSO4) in solutions of human serum apo-transferrin. Further detailed study rules out the presence of a ternary ligand-vanadyl-transferrin complex proposed previously. By contrast, differences in reaction products are observed for the interactions of BMOV and VOSO4 with human serum albumin (HSA), wherein adduct formation between albumin and BMOV is detected. In BMOV-albumin solutions, vanadyl ions are bound in a unique manner not observed in comparable solutions Of VOSO4 and albumin. Presentation of chelated vanadyl ions precludes binding at the numerous nonspecific sites and produces a unique EPR spectrum which is assigned to a BMOV-HSA adduct. The adduct species cannot be produced, however, from a solution Of VOSO4 and HSA titrated with maltol. Addition of maltol to a VOSO4-HSA solution instead results in formation of a different end product which has been assigned as a ternary complex, VO(ma)(HSA). Furthermore, analysis of solution equilibria using a model system of BMOV with 1-methylimidazole (formation constant log K = 4.5(1), by difference electronic absorption spectroscopy) lends support to an adduct binding mode (VO(ma)(2)-HSA) proposed herein for BMOV and HSA. This detailed report of an in vitro reactivity difference between VOSO4 and BMOV may have bearing on the form of active vanadium metabolites delivered to target tissues. Albumin binding of vanadium chelates is seen to have a potentially dramatic effect on pharmacokinetics, transport, and efficacy of these antidiabetic chelates.

Regulation of albumin endocytosis by PSD95/Dlg/ZO-1 (PDZ) scaffolds - Interaction of Na+-H+ exchange regulatory factor-2 with ClC-5

The constitutive reuptake of albumin from the glomerular filtrate by receptor-mediated endocytosis is a key function of the renal proximal tubules. Both the Cl- channel ClC-5 and the Na+-H+ exchanger isoform 3 are critical components of the macromolecular endocytic complex that is required for albumin uptake, and therefore the cell-surface levels of these proteins may limit albumin endocytosis. This study was undertaken to investigate the potential roles of the epithelial PDZ scaffolds, Na+-H+ exchange regulatory factors, NHERF1 and NHERF2, in albumin uptake by opossum kidney ( OK) cells. We found that ClC-5 co-immunoprecipitates with NHERF2 but not NHERF1 from OK cell lysate. Experiments using fusion proteins demonstrated that this was a direct interaction between an internal binding site in the C terminus of ClC-5 and the PDZ2 module of NHERF2. In OK cells, NHERF2 is restricted to the intravillar region while NHERF1 is located in the microvilli. Silencing NHERF2 reduced both cell-surface levels of ClC-5 and albumin uptake. Conversely, silencing NHERF1 increased cell-surface levels of ClC-5 and albumin uptake, presumably by increasing the mobility of NHE3 in the membrane and its availability to the albumin uptake complex. Surface biotinylation experiments revealed that both NHERF1 and NHERF2 were associated with the plasma membrane and that NHERF2 was recruited to the membrane in the presence of albumin. The importance of the interaction between NHERF2 and the cytoskeleton was demonstrated by a significant reduction in albumin uptake in cells overexpressing an ezrin binding-deficient mutant of NHERF2. Thus NHERF1 and NHERF2 differentially regulate albumin uptake by mechanisms that ultimately alter the cell-surface levels of ClC-5.

The human papillomavirus type 16 E7 protein binds human interferon regulatory factor-9 via a novel PEST domain required for transformation

It is critical that viruses are able to avoid the antiviral activities of interferon (IFN). We have shown previously that the human papillomavirus (HPV) is able to avoid IFN-alpha via interaction of the HPV-16 E7 protein with IFN regulatory factor-9 (IRF-9). Here, we investigated the details of the interaction using HPV-16 E7 peptide mapping to show that IRF-9 binds HPV-16 E7 in a domain encompassing amino acids 25-36. A closer examination of this region indicates this is a novel proline, glutamate, serine, and threonine-rich (PEST) domain, with a PEST score of 8.74. We have also mapped the region of interaction within IRF-9 and found that amino acids 354-393 play an important role in binding to HPV-16 E7. This region of IRF-9 encompasses the IRF association domain (IAD), a region important for protein-protein interaction central to IRF function. Finally, we used alanine-scanning mutagenesis to determine if E7-IRF-9 interaction was important for E7-mediated cellular transformation and found that the HPV-16 E7 mutants Y25A, E26A, S31A, S32A, and E35A, but not L28A and N29A, caused loss of transformation ability. Preliminary data suggest loss of IRF-9 interaction with E7 mutants correlated with transformation. Our work suggests E7- IRF- 9 interaction is important for the transforming ability of HPV-16 E7 and that HPV-16 E7 may interact with other IRF proteins that have IAD domains.