942 resultados para Bone-marrow macrophages


Relevância:

90.00% 90.00%

Publicador:

Resumo:

The origin and role of IL-17, a T-cell derived cytokine, in cartilage and bone destruction during rheumatoid arthritis (RA) remain to be clarified. In human ex vivo models, addition of IL-17 enhanced IL-6 production and collagen destruction, and inhibited collagen synthesis by RA synovium explants. On mouse cartilage, IL-17 enhanced cartilage proteoglycan loss and inhibited its synthesis. On human RA bone explants, IL-17 also increased bone resorption and decreased formation. Addition of IL-1 in these conditions increased the effect of IL-17. Blocking of bone-derived endogenous IL-17 with specific inhibitors resulted in a protective inhibition of bone destruction. Conversely, intra-articular administration of IL-17 into a normal mouse joint induced cartilage degradation. In conclusion, the contribution of IL-17 derived from synovium and bone marrow T cells to joint destruction suggests the control of IL-17 for the treatment of RA.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Microglia arise from CD45+ bone marrow precursors that colonize the fetal brain and play a key role in central nervous system inflammatory conditions. We report that parenchymal microglia are uncommitted myeloid progenitors of immature dendritic cells and macrophages by several criteria, including surface expression of “empty” class II MHC protein and their cysteine protease (cathepsin) profile. Microglia express receptors for stem cell factor and can be skewed toward more dendritic cell or macrophage-like profiles in response to the lineage growth factors granulocyte/macrophage colony-stimulating factor or macrophage colony-stimulating factor. Thus, in contrast to other organs, where terminally differentiated populations of resident dendritic cells and/or macrophages outnumber colonizing precursors, the majority of microglia within the brain remain in an undifferentiated state.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Marrow stromal cells are adult stem cells from bone marrow that can differentiate into multiple nonhematopoietic cell lineages. Previous reports demonstrated that single-cell-derived colonies of marrow stromal cells contained two morphologically distinct cell types: spindle-shaped cells and large flat cells. Here we found that early colonies also contain a third kind of cell: very small round cells that rapidly self-renew. Samples enriched for the small cells had a greater potential for multipotential differentiation than samples enriched for the large cells. Also, the small cells expressed a series of surface epitopes and other proteins that potentially can be used to distinguish the small cells from the large cells. The results suggested it will be important to distinguish the major subpopulations of marrow stromal cells in defining their biology and their potential for cell and gene therapy.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The long-term efficacy of gene therapy using bone marrow transplantation requires the engraftment of genetically altered totipotent hematopoietic stem cells (THSCs). Ex vivo expansion of corrected THSCs is one way to increase the efficiency of the procedure. Similarly, selective in vivo expansion of the therapeutic THSCs rather than the endogenous THSCs could favor the transplant. To test whether a conferred proliferative advantage gene can facilitate the in vitro and in vivo expansion of hematopoietic stem cells, we have generated transgenic mice expressing a truncated receptor for the growth factor erythropoietin. These mice are phenotypically normal, but when treated in vivo with exogenous erythropoietin they exhibit a marked increase in multipotent, clonogenic hematopoietic cells [colony-forming units in the spleen (CFU-S) and CFUs that give rise to granulocytes, erythroid cells, macrophages, and megakaryocytes within the same colony (CFU-GEMM)] in comparison with the wild-type mice. In addition, long-term in vitro culture of tEpoR transgenic bone marrow in the presence of erythropoietin induces exponential expansion of trilineage hematopoietic stem cells not seen with wild-type bone marrow. Thus, the truncated erythropoietin receptor gene shows promise as a means for obtaining cytokine-inducible hematopoietic stem cell proliferation to facilitate the direct targeting of THSCs and to provide a competitive repopulation advantage for transplanted therapeutic stem cells.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Células tumorais desenvolvem diversas estratégias para escapar da identificação e eliminação pelo sistema imune. Dessa forma, a investigação dos mecanismos envolvidos na comunicação celular no microambiente tumoral e na desregulação local do sistema imune é crítica para uma melhor compreensão da progressão da doença e para o desenvolvimento de alternativas terapêuticas mais eficazes. Nós aqui demonstramos que SIGIRR/IL-1R8, um importante regulador negativo de receptores de Interleucina-1 (ILRs) e receptores do tipo Toll (TLRs), apresenta expressão aumentada em uma linhagem celular epitelial mamária transformada pela superexpressão do oncogene HER2 e em tumores primários de mama, e promove o crescimento tumoral e metástase através da modulação da inflamação associada ao câncer e da atenuação da resposta imune antitumoral. Observamos que IL-1R8 tem sua expressão correlacionada com HER2 em tecidos mamários e sua alta expressão é fator de pior prognóstico em câncer de mama de baixo grau. Notavelmente, níveis aumentados de IL-1R8 foram observados especialmente nos subtipos HER2+ e Luminais de tumores de mama, e sua expressão aumentada em células epiteliais de mama transformadas por HER2 diminui a ativação da via de NF-κB e a expressão de diferentes citocinas pro-inflamatórias (IL-6, IL-8, TNF, CSF2, CSF3 e IFN-β1). Meio condicionado de células transformadas por HER2, mas não de variantes celulares com o gene IL-1R8 silenciado, induz a polarização de macrófagos para o fenótipo M2 e inibe a ativação de células NK. Em um modelo murino transgênico de tumorigênese espontânea mediada por HER2, MMTV-neu, verificamos que a deficiência de IL-1R8 (IL-1R8-/-neu) retardou o aparecimento de tumores e reduziu a incidência, a carga tumoral e a disseminação metastática. Contudo, não foram observadas diferenças significativas no crescimento tumoral quando animais IL-1R8-/-neu receberam medula óssea de animais IL-1R8+/+, confirmando um papel importante da expressão de IL-1R8 em células não hematopoiéticas na tumorigênese da mama. Tumores IL-1R8+/+neu apresentaram maiores níveis de citocinas pró-inflamatórias como IL-1β e VEGF, e menores níveis da citocina imunomodulatória IFN-γ. Além disso, tumores que expressavam IL-1R8 apresentaram menor infiltrado de células NK maduras, células dendríticas (DCs) e linfócitos T-CD8+ e um maior infiltrado de macrófagos M2 e linfócitos T-CD4+. Coletivamente, esses resultados indicam que a expressão de IL-1R8 em tumores de mama pode representar um novo mecanismo de escape da resposta imune e suportam IL-1R8 como potencial alvo terapêutico.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The EF-hand superfamily of calcium binding proteins includes the S100, calcium binding protein, and troponin subfamilies. This study represents a genome, structure, and expression analysis of the S100 protein family, in mouse, human, and rat. We confirm the high level of conservation between mammalian sequences but show that four members, including S100A12, are present only in the human genome. We describe three new members of the S100 family in the three species and their locations within the S100 genomic clusters and propose a revised nomenclature and phylogenetic relationship between members of the EF-hand superfamily. Two of the three new genes were induced in bone-marrow-derived macrophages activated with bacterial lipopolysaccharide, suggesting a role in inflammation. Normal human and murine tissue distribution profiles indicate that some members of the family are expressed in a specific manner, whereas others are more ubiquitous. Structure-function analysis of the chemotactic properties of murine S100A8 and human S100A12, particularly within the active hinge domain, suggests that the human protein is the functional homolog of the murine protein. Strong similarities between the promoter regions of human S100A12 and murine S100A8 support this possibility. This study provides insights into the possible processes of evolution of the EF-hand protein superfamily. Evolution of the S100 proteins appears to have occurred in a modular fashion, also seen in other protein families such as the C2H2-type zinc-finger family. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Side population (SP) cells in the adult kidney are proposed to represent a progenitor population. However, the size, origin, phenotype, and potential of the kidney SP has been controversial. In this study, the SP fraction of embryonic and adult kidneys represented 0.1 to 0.2% of the total viable cell population. The immunophenotype and the expression profile of kidney SP cells was distinct from that of bone marrow SP cells, suggesting that they are a resident nonhematopoietic cell population. Affymetrix expression profiling implicated a role for Notch signaling in kidney SP cells and was used to identify markers of kidney SP. Localization by in situ hybridization confirmed a primarily proximal tubule location, supporting the existence of a tubular niche, but also revealed considerable heterogeneity, including the presence of renal macrophages. Adult kidney SP cells demonstrated multilineage differentiation in vitro, whereas microinjection into mouse metanephroi showed that SP cells had a 3.5- to 13-fold greater potential to contribute to developing kidney than non-SP main population cells. However, although reintroduction of SP cells into an Adriamycin-nephropathy model reduced albuminuria:creatinine ratios, this was without significant tubular integration, suggesting a humoral role for SP cells in renal repair. The heterogeneity of the renal SP highlights the need for further fractionation to distinguish the cellular subpopulations that are responsible for the observed multilineage capacity and transdifferentiative and humoral activities.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Mobilization is now used worldwide to collect large numbers of hematopoietic stem and progenitor cells (HSPCs) for transplantation. Although the first mobilizing agents were discovered largely by accident, discovery of more efficient mobilizing agents will require a better understanding of the molecular mechanisms responsible. During the past 5 years, a number of mechanisms have been identified, shedding new light on the dynamics of the hematopoietic system in vivo and on the intricate relationship between hematopoiesis, innate immunity, and bone. After briefly reviewing the mechanisms by which circulating HSPCs home into the bone marrow and what keeps them there, the current knowledge of mechanisms responsible for HSPC mobilization in response to hematopoietic growth factors such as granulocyte colony-stimulating factor, chemotherapy, chemokines, and polyanions will be discussed together with current strategies developed to further increase HSPC mobilization. (c) 2006 International Society for Experimental Hematology.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The mononuclear phagocyte system (MPS) has been defined as a family of cells comprising bone marrow progenitors, blood monocytes and tissue macrophages. Macrophages are a major cell population in most of the tissues in the body, and their numbers increase further in inflammation, wounding and malignancy. Their trophic roles for other cell types in development and homeostasis are becoming increasingly evident. The receptor for macrophage colony-stimulating factor (CSF-1R) is expressed in a large proportion of cells considered to be mononuclear phagocytes, including antigen-presenting dendritic cells, which can be considered a specialized adaptive state rather than a separate lineage. The unity of the MPS is challenged by evidence that there is a separate embryonic phagocyte lineage, by the transdifferentiation and fusion of MPS cells with other cell types, and by evidence of local renewal of tissue macrophage populations as opposed to monocyte recruitment. The concept of the MPS may have partly outlived its usefulness.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Abstract Mesenchymal stem cells (MSC) derived from bone marrow can potentially reduce the acute inflammatory response in spinal cord injury (SCI) and thus promote functional recovery. However, the precise mechanisms through which transplanted MSC attenuate inflammation after SCI are still unclear. The present study was designed to investigate the effects of MSC transplantation with a special focus on their effect on macrophage activation after SCI. Rats were subjected to T9-T10 SCI by contusion, then treated 3 days later with transplantation of 1.0×10(6) PKH26-labeled MSC into the contusion epicenter. The transplanted MSC migrated within the injured spinal cord without differentiating into glial or neuronal elements. MSC transplantation was associated with marked changes in the SCI environment, with significant increases in IL-4 and IL-13 levels, and reductions in TNF-a and IL-6 levels. This was associated simultaneously with increased numbers of alternatively activated macrophages (M2 phenotype: arginase-1- or CD206-positive), and decreased numbers of classically activated macrophages (M1 phenotype: iNOS- or CD16/32-positive). These changes were associated with functional locomotion recovery in the MSC-transplanted group, which correlated with preserved axons, less scar tissue formation, and increased myelin sparing. Our results suggested that acute transplantation of MSC after SCI modified the inflammatory environment by shifting the macrophage phenotype from M1 to M2, and that this may reduce the effects of the inhibitory scar tissue in the subacute/chronic phase after injury to provide a permissive environment for axonal extension and functional recovery.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Bone marrow-derived mesenchymal stem cells (BMSC) modulate inflammatory/immune responses and promote motor functional recovery after spinal cord injury (SCI). However, the effects of BMSC transplantation on central neuropathic pain and neuronal hyperexcitability after SCI remain elusive. This is of importance because BMSC-based therapies have been proposed for clinical treatment. We investigated the effects of BMSC transplantation on pain hypersensitivity in green fluorescent protein (GFP)-positive bone marrow-chimeric mice subjected to a contusion SCI, and the mechanisms of such effects. BMSC transplantation at day 3 post-SCI improved motor function and relieved SCI-induced hypersensitivities to mechanical and thermal stimulation. The pain improvements were mediated by suppression of protein kinase C-γ and phosphocyclic AMP response element binding protein expression in dorsal horn neurons. BMSC transplants significantly reduced levels of p-p38 mitogen-activated protein kinase and extracellular signal-regulated kinase (p-ERK1/2) in both hematogenous macrophages and resident microglia and significantly reduced the infiltration of CD11b and GFP double-positive hematogenous macrophages without decreasing the CD11b-positive and GFP-negative activated spinal-microglia population. BMSC transplants prevented hematogenous macrophages recruitment by restoration of the blood-spinal cord barrier (BSCB), which was associated with decreased levels of (a) inflammatory cytokines (tumor necrosis factor-α, interleukin-6); (b) mediators of early secondary vascular pathogenesis (matrix metallopeptidase 9); (c) macrophage recruiting factors (CCL2, CCL5, and CXCL10), but increased levels of a microglial stimulating factor (granulocyte-macrophage colony-stimulating factor). These findings support the use of BMSC transplants for SCI treatment. Furthermore, they suggest that BMSC reduce neuropathic pain through a variety of related mechanisms that include neuronal sparing and restoration of the disturbed BSCB, mediated through modulation of the activity of spinal-resident microglia and the activity and recruitment of hematogenous macrophages.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Tissue engineering of biomimetic skeletal muscle may lead to development of new therapies for myogenic repair and generation of improved in vitro models for studies of muscle function, regeneration, and disease. For the optimal therapeutic and in vitro results, engineered muscle should recreate the force-generating and regenerative capacities of native muscle, enabled respectively by its two main cellular constituents, the mature myofibers and satellite cells (SCs). Still, after 20 years of research, engineered muscle tissues fall short of mimicking contractile function and self-repair capacity of native skeletal muscle. To overcome this limitation, we set the thesis goals to: 1) generate a highly functional, self-regenerative engineered skeletal muscle and 2) explore mechanisms governing its formation and regeneration in vitro and survival and vascularization in vivo.

By studying myogenic progenitors isolated from neonatal rats, we first discovered advantages of using an adherent cell fraction for engineering of skeletal muscles with robust structure and function and the formation of a SC pool. Specifically, when synergized with dynamic culture conditions, the use of adherent cells yielded muscle constructs capable of replicating the contractile output of native neonatal muscle, generating >40 mN/mm2 of specific force. Moreover, tissue structure and cellular heterogeneity of engineered muscle constructs closely resembled those of native muscle, consisting of aligned, striated myofibers embedded in a matrix of basal lamina proteins and SCs that resided in native-like niches. Importantly, we identified rapid formation of myofibers early during engineered muscle culture as a critical condition leading to SC homing and conversion to a quiescent, non-proliferative state. The SCs retained natural regenerative capacity and activated, proliferated, and differentiated to rebuild damaged myofibers and recover contractile function within 10 days after the muscle was injured by cardiotoxin (CTX). The resulting regenerative response was directly dependent on the abundance of SCs in the engineered muscle that we varied by expanding starting cell population under different levels of basic fibroblast growth factor (bFGF), an inhibitor of myogenic differentiation. Using a dorsal skinfold window chamber model in nude mice, we further demonstrated that within 2 weeks after implantation, initially avascular engineered muscle underwent robust vascularization and perfusion and exhibited improved structure and contractile function beyond what was achievable in vitro.

To enhance translational value of our approach, we transitioned to use of adult rat myogenic cells, but found that despite similar function to that of neonatal constructs, adult-derived muscle lacked regenerative capacity. Using a novel platform for live monitoring of calcium transients during construct culture, we rapidly screened for potential enhancers of regeneration to establish that many known pro-regenerative soluble factors were ineffective in stimulating in vitro engineered muscle recovery from CTX injury. This led us to introduce bone marrow-derived macrophages (BMDMs), an established non-myogenic contributor to muscle repair, to the adult-derived constructs and to demonstrate remarkable recovery of force generation (>80%) and muscle mass (>70%) following CTX injury. Mechanistically, while similar patterns of early SC activation and proliferation upon injury were observed in engineered muscles with and without BMDMs, a significant decrease in injury-induced apoptosis occurred only in the presence of BMDMs. The importance of preventing apoptosis was further demonstrated by showing that application of caspase inhibitor (Q-VD-OPh) yielded myofiber regrowth and functional recovery post-injury. Gene expression analysis suggested muscle-secreted tumor necrosis factor-α (TNFα) as a potential inducer of apoptosis as common for muscle degeneration in diseases and aging in vivo. Finally, we showed that BMDM incorporation in engineered muscle enhanced its growth, angiogenesis, and function following implantation in the dorsal window chambers in nude mice.

In summary, this thesis describes novel strategies to engineer highly contractile and regenerative skeletal muscle tissues starting from neonatal or adult rat myogenic cells. We find that age-dependent differences of myogenic cells distinctly affect the self-repair capacity but not contractile function of engineered muscle. Adult, but not neonatal, myogenic progenitors appear to require co-culture with other cells, such as bone marrow-derived macrophages, to allow robust muscle regeneration in vitro and rapid vascularization in vivo. Regarding the established roles of immune system cells in the repair of various muscle and non-muscle tissues, we expect that our work will stimulate the future applications of immune cells as pro-regenerative or anti-inflammatory constituents of engineered tissue grafts. Furthermore, we expect that rodent studies in this thesis will inspire successful engineering of biomimetic human muscle tissues for use in regenerative therapy and drug discovery applications.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Thesis (Ph.D.)--University of Washington, 2016-07

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Coronary heart disease is a major cause of morbidity and mortality worldwide. Percutaneous coronary intervention (PCI) has become the most widely used method of coronary artery revascularisation. The use of stents to hold open atherosclerosis induced arterial narrowing has significantly reduced elastic recoil and acute vessel occlusion following balloon angioplasty. However, bare metal stents have been associated with in-stent restenosis attributed to vascular smooth muscle cell (VSMC) hyperplasia and excessive neointimal formation. The resultant luminal renarrowing may manifest clinically with the return of symptoms such as chest pain or shortness of breath. The development of drug eluting stents has significantly reduced the incidence of in-stent restenosis (ISR). Unfortunately the antiproliferative medications used not only inhibit VSMC proliferation but also re-endothelialisation of the stented vessel. In addition, the drug impregnated polymer coating has been associated with a chronic inflammatory response within the vessel wall predisposing patients to stent thrombosis. Thus the identification of novel therapies which promote vessel healing without excessive proliferative or inflammatory response may improve long term outcome and reduce the need for repeated revascularisation. MicroRNAs (miRs) are short (18-25 nucleotide) non-coding RNAs acting to regulate gene expression. By binding to the 3’untranslated region of mRNA they act to fine tune gene expression either by mRNA degradation or translational repression. Originally identified in coordinating tissue development microRNAs have also been shown to play important roles coordinating the inflammatory response and in numerous cardiovascular diseases. MiR-21 has been identified in human atherosclerotic plaques, arteriosclerosis obliterans and abdominal aortic aneurysms. In addition, its up regulation has been documented in preclinical models of vascular injury. This study sought to identify the role of miR-21 in the development of ISR. Utilising a small animal model of stenting and in vitro techniques, we sought to investigate its influence upon VSMC and immune cell response following stenting. 19 The refinement of a murine stenting model within the Baker laboratory and the electrochemical dissolution of the metal stent from within harvested vascular tissues significantly improved the ability to perform detailed histological analysis. In addition, identification of miRNAs using in situ hybridisation was achieved for the first time within stented tissue. Neointimal formation and ISR was significantly reduced in mice in which miR-21 had been genetically deleted. In addition, neointimal composition was found to be altered in miR-21 KO mice with reductions in VSMC and elastin content demonstrated. Importantly, no difference in re-endothelialisation was observed. In vitro analysis demonstrated that VSMCs from miR-21 KO mice had both reduced proliferative and migratory capacity following platelet derived growth factor stimulation. Molecular analysis revealed that these differences may, at least in part, be due to de-repression of programmed cell death 4 (PDCD4). PDCD4 is a known miR-21 target within VSMCs implicated in the suppression of proliferation and promotion of apoptosis. Unfortunately, initial attempts at antimiR mediated knockdown of miR-21 in vivo, failed to produce a similar change in the suppression of ISR. Furthermore, a significant alteration in macrophage polarisation state within the neointima of miR-21 WT and KO mice was noted. Immunohistochemical staining revealed a preponderance of anti-inflammatory M2 macrophages in KO mice. Analysis of bone marrow derived macrophages from miR-21 KO mice demonstrated an increased level of the peroxisome proliferation activating receptor-γ (PPARγ) which facilitates M2 polarisation. Importantly, significant alterations in numerous pro-inflammatory cytokines, which also have mitogenic effects, were also found following genetic deletion of miR-21. In Summary, this is the first study to look at miRs in the development of ISR. MiR-21 plays an important role in the development of ISR by influencing the proliferative response of VSMCs and modulating the immune response following stent deployment. Further attempts to modulate miR-21 expression following PCI may reduce ISR and the need for repeat revascularisation while also reducing the risk of stent thrombosis.