966 resultados para ssDNA probes


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Approximately 520 Wilson disease-causing mutations in the ATP7B gene have been described to date. In this study we report DNA and RNA analyses carried out for molecular characterization of a consensus sequence splicing mutation found in homozygosity in a Swiss Wilson disease patient. RNA analysis of 1946 +6 T→C in both the peripheral lymphoblasts and liver resulted in the production in the propositus of only an alternative transcript lacking exons 6, 7, and 8 resulting most likely in alterations of cell biochemistry and disease. The patient presents an early form of severe hepatic disease characterized by hepatosplenomegaly, reduced hepatic function, anemia and thrombocytopenia indicating that 1946 +6 T→C is a severe mutation. Since identical results were obtained from both peripheral lymphoblasts and liver they also suggest that RNA studies of illegitimate transcripts can be safely used for molecular characterization of ATP7B splicing mutations, thus improving genetic counseling and diagnosis of Wilson disease. Moreover these studies, contribute to reveal the exact molecular mechanisms producing Wilson disease.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A cluster of six pediatric cases of deep-seated Staphylococcus aureus infection after heart operations prompted us to perform molecular typing of the S. aureus isolates by pulsed-field gel electrophoresis. This revealed the presence of genotypically distinct isolates in four of the six patients. Isolates of two patients were genotypically identical. All patients carried S. aureus in the anterior nares. In each patient, the banding pattern of deoxyribonucleic acid in these isolates was indistinguishable from that in strains isolated from blood or wound cultures. Molecular typing with pulsed-field gel electrophoresis ruled out nosocomial transmission of S. aureus between four patients; at the same time, it provided evidence for an association between nasal colonization and postoperative wound infection. Epidemiologic investigation of potential links between two patients with identical isolates did not provide any evidence for nosocomial transmission of S. aureus between these patients. Because nasal colonization with S. aureus may be a risk factor for surgical wound infection in pediatric patients undergoing heart operations, preoperative decolonization appears to be warranted.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The dic(9;20)(p13.2;q11.2) is reported to be present in ∼2% of childhood B-cell precursor acute lymphoblastic leukemia (BCP ALL). However, it easily escapes detection by G-banding analysis and its true prevalence is hence unknown. We performed interphase fluorescence in situ hybridization analyses-in a three-step manner-using probes for: (i) CDKN2A at 9p21, (ii) 20p and 20q subtelomeres and (iii) cen9 and cen20. Out of 1033 BCP ALLs diagnosed from 2001 to 2006, 533 were analyzed; 16% (84/533) displayed 9p21 deletions, of which 30% (25/84) had dic(9;20). Thus, dic(9;20)-positivity was found in 4.7% (25/533), making it the third most common genetic subgroup after high hyperdiploidy and t(12;21)(p13;q22). The dic(9;20) was associated with a female predominance and an age peak at 3 years; 18/25 (72%) were allocated to non-standard risk treatment at diagnosis. Including cases detected by G-banding alone, 29 dic(9;20)-positive cases were treated according to the NOPHO ALL 2000 protocol. Relapses occurred in 24% (7/29) resulting in a 5-year event-free survival of 0.69, which was significantly worse than for t(12;21) (0.87; P=0.002) and high hyperdiploidy (0.82; P=0.04). We conclude that dic(9;20) is twice as common as previously surmised, with many cases going undetected by G-banding analysis, and that dic(9;20) should be considered a non-standard risk abnormality.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

1. The availability of orally active specific angiotensin receptor antagonists (AT1 antagonists) has opened new therapeutic choices and provided probes to test the specific role of the renin-angiotensin system in the pathogenesis of cardiovascular disease. 2. The data available so far suggest that the antihypertensive efficacy of angiotensin receptor antagonists is comparable to that of angiotensin-converting enzyme (ACE) inhibitors. This provides further evidence that this latter class of drugs exerts its effect mainly through blockade of the renin-angiotensin enzymatic cascade. As expected, the association of a diuretic exerts an equally strong additive effect to the antihypertensive efficacy of both classes of drugs. 3. The most common side effect of ACE inhibitors, dry cough, does not occur with AT1 antagonists, which confirms the long-held view that this untoward effect of the ACE inhibitors is due to renin-angiotensin-independent mechanisms. 4. Long-term studies with morbidity/mortality outcome results are needed, before a definite position can be assigned to this newcomer in the orchestra of modern antihypertensive drugs. Notwithstanding, this new class of agents already represents an exciting new addition to our therapeutic armamentarium.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to evaluate the genetic diversity, its organization and the genetic relationships within oil palm (Elaeis oleifera (Kunth) Cortés, from America, and E. guineensis (Jacq.), from Africa) germplasm using Restriction Fragment Length Polymorphism (RFLP) and Amplified Fragment Length Polymorphism (AFLP). In complement to a previous RFLP study on 241 E. oleifera accessions, 38 E. guineensis accessions were analyzed using the same 37 cDNA probes. These accessions covered a large part of the geographical distribution areas of these species in America and Africa. In addition, AFLP analysis was performed on a sub-set of 40 accessions of E. oleifera and 22 of E. guineensis using three pairs of enzyme/primer combinations. Data were subjected to Factorial Analysis of Correspondence (FAC) and cluster analysis, with parameters of genetic diversity being also studied. Results appeared congruent between RFLP and AFLP. In the E. oleifera, AFLP confirmed the strong structure of genetic diversity revealed by RFLP, according to geographical origin of the studied material, with the identification of the same four distinct genetic groups: Brazil, French Guyana/Surinam, Peru, north of Colombia/Central America. Both markers revealed that genetic divergence between the two species is of the same magnitude as that among provenances of E. oleifera. This finding is in discrepancy with the supposed early tertiary separation of the two species.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Homologous recombination provides a major pathway for the repair of DNA double-strand breaks in mammalian cells. Defects in homologous recombination can lead to high levels of chromosomal translocations or deletions, which may promote cell transformation and cancer development. A key component of this process is RAD51. In comparison to RecA, the bacterial homologue, human RAD51 protein exhibits low-level strand-exchange activity in vitro. This activity can, however, be stimulated by the presence of high salt. Here, we have investigated the mechanistic basis for this stimulation. We show that high ionic strength favours the co-aggregation of RAD51-single-stranded DNA (ssDNA) nucleoprotein filaments with naked duplex DNA, to form a complex in which the search for homologous sequences takes place. High ionic strength allows differential binding of RAD51 to ssDNA and double-stranded DNA (dsDNA), such that ssDNA-RAD51 interactions are unaffected, whereas those between RAD51 and dsDNA are destabilized. Most importantly, high salt induces a conformational change in RAD51, leading to the formation of extended nucleoprotein filaments on ssDNA. These extended filaments mimic the active form of the Escherichia coli RecA-ssDNA filament that exhibits efficient strand-exchange activity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp.) skin, Desmodium ovalifolium, red grape (Vitis vinifera) skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (P<0.01) when the controls were compared to either buffer treatments due to tannin type, buffer used and the interaction of tannin type and buffer. The significant interaction indicates the influence of tannin type on the parameters evaluated.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Arginine-glycine-aspartic acid (RGD)-containing peptides have been traditionally used as PET probes to noninvasively image angiogenesis, but recently, small selective molecules for α5 β1 integrin receptor have been developed with promising results. Sixty-one antagonists were screened, and tert-butyl (S)-3-(2-((3R,5S)-1-(3-(1-(2-fluoroethyl)-1H-1,2,3-triazol-4-yl)propanoyl)-5-((pyridin-2-ylamino)methyl)pyrrolidin-3-yloxy)acetamido)-2-(2,4,6-trimethylbenzamido)propanoate (FPMt) was selected for the development of a PET tracer to image the expression of α5 β1 integrin receptors. An alkynyl precursor (PMt) was initially synthesized in six steps, and its radiolabeling was performed according to the azide-alkyne copper(II)-catalyzed Huisgen's cycloaddition by using 1-azido-2-[(18)F]fluoroethane ([(18)F]12). Different reaction conditions between PMt and [(18)F]12 were investigated, but all of them afforded [(18)F]FPMt in 15 min with similar radiochemical yields (80-83%, decay corrected). Overall, the final radiopharmaceutical ([(18)F]FPMt) was obtained after a synthesis time of 60-70 min in 42-44% decay-corrected radiochemical yield.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Understanding the oxidative reactivity of nanoparticles (NPs; <100 nm) could substantially contribute to explaining their toxicity. We attempted to refine the use of 2′7-dichlorodihydrofluorescein (DCFH) to characterize NP generation of reactive oxygen species (ROS). Several fluorescent probes have been applied to testing oxidative reactivity, but despite DCFH being one of the most popular for the detection of ROS, when it has been applied to NPs there have been an unexplainably wide variability in results. Without a uniform methodology, validating even robust results is impossible. This study, therefore, identified sources of conflicting results and investigated ways of reducing occurrence of artificial results. Existing techniques were tested and combined (using their most desirable features) to form a more reliable method for the measurement of NP reactivity in aqueous dispersions. We also investigated suitable sample ranges necessary to determine generation of ROS. Specifically, ultrafiltration and time-resolved scan absorbance spectra were used to study possible optical interference when using high sample concentrations. Robust results were achieved at a 5 µM DCFH working solution with 0.5 unit/mL horseradish peroxidase (HRP) dissolved in ethanol. Sonication in DCFH-HRP working solution provided more stable data with a relatively clean background. Optimal particle concentration depends on the type of NP and in general was in the µg/mL range. Major reasons for previously reported conflicting results due to interference were different experimental approaches and NP sample concentrations. The protocol presented here could form the basis of a standardized method for applying DCFH to detect generation of ROS by NPs.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Odor detection and discrimination by olfactory systems in vertebrates and invertebrates depend both on the selective expression of individual olfactory receptor genes in subpopulations of olfactory sensory neurons, and on the targeting of the encoded proteins to the exposed, ciliated endings of sensory dendrites. Techniques to visualize the expression and localization of olfactory receptor gene products in vivo have been essential to reveal the molecular logic of peripheral odor coding and to permit investigation of the developmental and cellular neurobiology of this sensory system. Here, we describe methods for detection of olfactory receptor transcripts and proteins in the antennal olfactory organ of the fruit fly, Drosophila melanogaster, an important genetic model organism. We include protocols both for antennal cryosections and whole-mount antennae. These methods can be adapted for detection of receptor expression in other olfactory and gustatory tissues in Drosophila, as well as in the chemosensory systems of other insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Direct identification as well as isolation of antigen-specific T cells became possible since the development of "tetramers" based on avidin-fluorochrome conjugates associated with mono-biotinylated class I MHC-peptide monomeric complexes. In principle, a series of distinct class I MHC-peptide tetramers, each labelled with a different fluorochrome, would allow to simultaneously enumerate as many unique antigen-specific CD8(+) T cells. Practically, however, only phycoerythrin and allophycocyanin conjugated tetramers have been generally available, imposing serious constraints for multiple labeling. To overcome this limitation, we have developed dextramers which are multimers based on a dextran backbone bearing multiple fluorescein and streptavidin moieties. Here we demonstrate the functionality and optimization of these new probes on human CD8(+) T cell clones with four independent antigen specificities. Their applications to the analysis of relatively low frequency antigen-specific T cells in peripheral blood, as well as their use in fluorescence microscopy, are demonstrated. The data show that dextramers produce a stronger signal than their fluoresceinated tetramer counterparts. Thus, these could become the reagents of choice as the antigen-specific T cell labeling transitions from basic research to clinical application.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Searching for matches between large collections of short (14-30 nucleotides) words and sequence databases comprising full genomes or transcriptomes is a common task in biological sequence analysis. We investigated the performance of simple indexing strategies for handling such tasks and developed two programs, fetchGWI and tagger, that index either the database or the query set. Either strategy outperforms megablast for searches with more than 10,000 probes. FetchGWI is shown to be a versatile tool for rapidly searching multiple genomes, whose performance is limited in most cases by the speed of access to the filesystem. We have made publicly available a Web interface for searching the human, mouse, and several other genomes and transcriptomes with oligonucleotide queries.