995 resultados para neutron stars


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hydrogen spillover on carbon-supported precious metal catalysts has been investigated with inelastic neutron scattering (INS) spectroscopy. The aim, which was fully realized, was to identify spillover hydrogen on the carbon support. The inelastic neutron scattering spectra of Pt/C, Ru/C, and PtRu/C fuel cell catalysts dosed with hydrogen were determined in two sets of experiments: with the catalyst in the neutron beam and, using an annular cell, with carbon in the beam and catalyst pellets at the edge of the cell excluded from the beam. The vibrational modes observed in the INS spectra were assigned with reference to the INS of a polycyclic aromatic hydrocarbon, coronene, taken as a molecular model of a graphite layer, and with the aid of computational modeling. Two forms of spillover hydrogen were identified: H at edge sites of a graphite layer (formed after ambient dissociative chemisorption of H-2), and a weakly bound layer of mobile H atoms (formed by surface diffusion of H atoms after dissociative chernisorption of H-2 at 500 K). The INS spectra exhibited characteristic riding modes of H on carbon and on Pt or Ru. In these riding modes H atoms move in phase with vibrations of the carbon and metal lattices. The lattice modes are amplified by neutron scattering from the H atoms attached to lattice atoms. Uptake of hydrogen, and spillover, was greater for the Ru containing catalysts than for the Pt/C catalyst. The INS experiments have thus directly demonstrated H spillover to the carbon support of these metal catalysts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Electrospinning is a method used to produce nanoscale to microscale sized polymer fibres. In this study we electrospin 1:1 blends of deuterated and hydrogenated atactic- Polystyrene from N,N-Dimethylformamide for small angle neutron scattering experiments in order to analyse the chain conformation in the electrospun fibres. Small angle neutron scattering was carried out on randomly orientated fibre mats obtained using applied voltages of 10kV-15kV and needle tip to collector distances of 20cm and 30cm. Fibre diameters varied from 3μm – 20μm. Neutron scattering data from fibre samples were compared with bulk samples of the same polymer blend. The scattering data indicates that there are pores and nanovoiding present in the fibres; this was confirmed by scanning electron microscopy. A model that combines the scattering from the pores and the labelled polymer chains was used to extract values for the radius of gyration. The radius of gyration in the fibres is found to vary little with the applied voltage, but varies with the initial solution concentration and fibre diameter. The values for the radius of gyration in the fibres are broadly equivalent to that of the bulk state.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Currently microporous oxidic materials including zeolites are attracting interest as potential hydrogen storage materials. Understanding how molecular hydrogen interacts with these materials is important in the rational development of hydrogen storage materials and is also challenging theoretically. In this paper, we present an incoherent inelastic neutron scattering (INS) study of the adsorption of molecular hydrogen and hydrogen deuteride (HD) in a copper substituted ZSM5 zeolite varying the hydrogen dosage and temperature. We have demonstrated how inelastic neutron scattering can help us understand the interaction of H-2 molecules with a binding site in a particular microporous material, Cu ZSM5, and by implication of other similar materials. The H-2 molecule is bound as a single species lying parallel with the surface. As H-2 dosing increases, lateral interactions between the adsorbed H-2 molecules become apparent. With rising temperature of measurement up to 70 K (the limit of our experiments), H-2 molecules remain bound to the surface equivalent to a liquid or solid H-2 phase. The implication is that hydrogen is bound rather strongly in Cu ZSM5. Using the simple model for the anisotropic interaction to calculate the energy levels splitting, we found that the measured rotational constant of the hydrogen molecule is reduced as a consequence of adsorption by the Cu ZSM5. From the decrease in total signal intensity with increasing temperature, we were able to observe the conversion of para-hydrogen into ortho-hydrogen at paramagnetic centres and so determine the fraction of paramagnetic sites occupied by hydrogen molecules, ca. 60%. (c) 2006 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An inelastic neutron scattering (INS) study of the rotational - vibrational spectrum of dihydrogen sorbed by zeolite X having substituted sodium, calcium and zinc cations is reported. The rotational - vibrational spectrum of H-2 was observed at low energy transfer ( below ca. 25 meV, 202 cm(-1)); the vibration was that of the H-2 molecule against the binding site (H-2 - X, not H - H). The vibration frequency was proportional to the polarising power of the cation (Na+ < Ca2+ < Zn2+). Polarisation of the H-2 molecule dominated the interaction of H-2 with this binding site. The total scattering intensity was proportional to the dihydrogen dose. However the vibrational intensities became constant at ca. 0.3 wt% showing that the H-2 binding sites had saturated. Additional dihydrogen appeared as unbound or weakly bound dihydrogen exhibiting recoil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We report an inelastic neutron scattering (INS) study of the rotational–vibrational spectrum of dihydrogen sorbed by zeolite CaX. In the low energy (<200 cm−1) INS spectrum of adsorbed H2 we observe the rotational–vibrational spectrum of H2, where the vibration is that of the H2 molecule against the binding site (i.e. H2–X, not H–H). We have observed for the first time the vibrational overtones of the hydrogen molecule against the adsorption surface up to sixth order. These vibrations are usually forbidden in INS spectroscopy because of the selection rules imposed by the spin flip event required. In our case we are able to observe such a vibration because the rotational transition J(1 ← 0) convolutes the vibrational spectrum. This paper reports the effect for the first time.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have used high energy transfer (HET) inelastic neutron scattering spectroscopy to measure the vibrational modes in the spectra of hydroxyapatite, bone and brushite to confirm our earlier work that only a fraction of the hydroxyl groups in bone mineral are substituted. The HET spectra are better observed due to the higher scattering cross section of hydrogen compared with the other elements in the calcium phosphate compounds. (C) 2003 Elsevier Science B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Perceptual multimedia quality is of paramount importance to the continued take-up and proliferation of multimedia applications: users will not use and pay for applications if they are perceived to be of low quality. Whilst traditionally distributed multimedia quality has been characterised by Quality of Service (QoS) parameters, these neglect the user perspective of the issue of quality. In order to redress this shortcoming, we characterise the user multimedia perspective using the Quality of Perception (QoP) metric, which encompasses not only a user’s satisfaction with the quality of a multimedia presentation, but also his/her ability to analyse, synthesise and assimilate informational content of multimedia. In recognition of the fact that monitoring eye movements offers insights into visual perception, as well as the associated attention mechanisms and cognitive processes, this paper reports on the results of a study investigating the impact of differing multimedia presentation frame rates on user QoP and eye path data. Our results show that provision of higher frame rates, usually assumed to provide better multimedia presentation quality, do not significantly impact upon the median coordinate value of eye path data. Moreover, higher frame rates do not significantly increase level of participant information assimilation, although they do significantly improve overall user enjoyment and quality perception of the multimedia content being shown.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel but simple time-of-flight neutron scattering geometry which allows structural anisotropy to be probed directly, simultaneously and thus unambiguously in polymeric and other materials is described. A particular advantage of the simultaneous data collection when coupled to the large area of the beam is that it enables thin films (< 10 μm < 10 mg) to be studied with relative ease. The utility of the technique is illustrated by studies on both deformed poly(styrene) glasses and on thin films of electrical conducting polymers. In the latter case, the power of isotopic substitution is illustrated to great effect. The development of these procedures for use in other areas of materials science is briefly discussed.