977 resultados para linked immunosorbent assay


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objetivou-se, com este estudo, evidenciar os sinais clínicos e laboratoriais desta enfermidade para auxiliar na caracterização da doença de forma natural na área semi-árida da região nordeste. Foram avaliados 10 cães positivos para Trypanosoma cruzi, identificados mediante análises sorológicas de reação de imunofluorescência indireta (RIFI) e enzyme linked immunosorbent assay (ELISA); análise molecular pela Reação em Cadeia Polimerase (PCR), microscopia direta e hemocultura. Os cães chagásicos foram submetidos à avaliação física, verificação da pressão arterial, exames eletrocardiográficos, radiográficos, hematológicos (eritrograma e leucograma) e bioquímicos (ureia, creatinina, ALT, AST, PT, albumina, globulina, CK, CK-MB e cTnI). O exame físico e os valores das pressões arteriais dos cães apresentaram dentro dos parâmetros de normalidade, enquanto que na eletrocardiografia observou-se FC normal com ritmo sinusal, com exceção de um cão, que apresentou taquicardia sinusal (168 bat/min). No ECG de oito cães houve aumento da duração de P (47±6,5ms) sugestivo de aumento atrial, não confirmado radiograficamente. Foi observado supradesnivelamento do segmento ST em um cão. Nos resultados hematológicos constatou-se trombocitopenia (187,4x10³ ±137,2x10³) e anemia (5,0x10(6) ±1,39x10(6)/uL). Os valores médios da hemoglobina (11±2,7g/dL) e do hematócrito (34±10,5%) estavam abaixo dos limites de normalidade. A série branca apresentou-se dentro dos limites de normalidade, com exceção da eosinofilia observada em três cães. Individualmente, registrou-se em dois cães, leucocitose, linfocitose e neutrofilia. Na avaliação bioquímica, registrou-se hiperproteinemia (7,2±0,9g/dL), hipoalbuminemia (2,2±0,4g/dL), hiperglobulinemia (5,1±1,0g/dL) e aumento da CK (196±171U/L). Não houve alteração nas enzimas ALT e AST. A isoenzima CK-MB e o cTnI alteraram somente em três cães. Os cães infectados naturalmente no semiárido nordestino apresentam características relacionáveis à forma crônica indeterminada, ou seja, cães assintomáticos. A identificação dos cães infectados naturalmente sem características patognomônicas da doença de Chagas ressalta a importância desta enfermidade no processo diagnóstico com as demais que manifestam perfis inespecíficos associados ou não às doenças cardiovasculares.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Abstract: This paper reports pythiosis in a sheep from southwestern Paraná, Brazil, confirmed by indirect ELISA (Enzime-Linked Immunosorbent Assay) and immunohistochemistry, as well as it describes the macro and microscopic injuries, in order to understand the pathogenicity. A 4-year-old ewe from a flock of 30 Santa Inês sheep, raised semi-extensively with access to a weir, showed cachexia, bilateral enlargement in nasal region, a serous and bloody secretion with a fetid odor from its nose and swollen submandibular and retropharyngeal lymph nodes. Blood collection was performed trough jugular vein puncture in order to make complete blood cell count (CBC) and to obtain serum for the subsequent serological examination. As the hematological counts were within the normal range for sheep, the animal was euthanized and submitted to necropsy. Indirect ELISA resulted positive for pythiosis. Necropsy revealed necrosis of the hard palate with a diameter of 3.5cm and extending up to the nasal cavity, forming a fistula. Submandibular and retropharyngeal lymph nodes were enlarged and edematous on section. Microscopic findings for submandibular and retropharyngeal lymph nodes consisted in moderate infiltration of eosinophils mainly in the subcapsular sinus, characterizing reactive eosinophilic lymphadenitis. The nasal cavity revealed rhinitis and oral cavity stomatitis with necro-eosinophilic and pronounced multifocal granulomatous infiltration and presence of hyphae. Hyphae found in palate and nasal cavity were positive for Pythium insidiosum by Grocott's method and immunohistochemistry, the last one considered to be confirmatory for the pathogen diagnostic. This report has an important epidemiological aspect, as it is the first case of pythiosis in sheep confirmed by serology in South Brazil and an alert of possible infection by the pathogen in floodplains.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cytomegalovirus (CMV) is the single most important infectious agent affecting recipients of organ transplants. To evaluate the incidence and the clinical importance of CMV infection in renal transplants in Brazil, 37 patients submitted to renal allograft transplants were tested periodically for the presence of cytomegalovirus DNA in urine using the polymerase chain reaction (PCR), and for the presence of IgM and IgG antibodies against CMV by enzyme-linked immunosorbent assay (ELISA) and indirect immunofluorescence (IIF). The PCR-amplified products were detected by gel electrophoresis and confirmed by dot-blot hybridization with oligonucleotide probes. Thirty-two of the 37 patients (86.4%) were positive by at least one of the three methods. In six patients, PCR was the only test which detected the probable CMV infection. Ten patients had a positive result by PCR before transplantation. In general, the diagnosis was achieved earlier by PCR than by serologic tests. Active infection occurred more frequently during the first four months after transplantation. Sixteen of the 32 patients (50%) with active CMV infection presented clinical symptoms consistent with CMV infection. Five patients without evidence of active CMV infection by the three tests had only minor clinical manifestations during follow-up. Our results indicate that PCR is a highly sensitive procedure for the early detection of CMV infection and that CMV infection in renal transplant patients is a frequent problem in Brazil.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The serologic assay is an important tool in the diagnosis of leishmaniasis. One of the most commonly used tests is enzyme-linked immunosorbent assay (ELISA). Since total Leishmania promastigotes are used as antigen in the routine assay, false-positive reactions are frequent due to cross-reaction with sera from other diseases, mainly Chagas' disease. Therefore, an antigen that determines less cross-reactivity has been pursued for the serodiagnosis of leishmaniasis. In the present study we analyzed the use of recombinant Leishmania infantum heat shock protein (Hsp) 83 in ELISA for the serodiagnosis of cutaneous (N = 12) and mucocutaneous leishmaniasis (N = 14) and we observed the presence of anti-L. infantum Hsp 83 antibodies in all samples as well as anti-Leishmania total antigen antibodies. When cross-reactivity was tested, chronic Chagas' disease patients (N = 10) did not show any reactivity. Therefore, we consider this L. infantum Hsp 83 to be a good antigen for routine use for serodiagnosis of tegumentary leishmaniasis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Many extrahepatic manifestations, including rheumatic diseases, have been reported to be associated with hepatitis C virus (HCV) infection. In order to investigate the prevalence of HCV infection among patients with rheumatic diseases, in the present study we interviewed 367 patients and tested their blood samples for HCV antibodies (anti-HCV) by an enzyme-linked immunosorbent assay. Anti-HCV-reactive samples were retested for confirmation by a line immunoassay and also for HCV RNA detection by the polymerase chain reaction. HCV RNA-positive samples were genotyped by INNO-LIPA. An overall HCV infection prevalence of 1.9% (7/367) was found. Of the 7 HCV-infected patients, 4 had systemic lupus erythematosus and 3 rheumatoid arthritis, resulting in positivity rates of 2.3 and 3.4%, respectively. HCV RNA genotyping revealed the presence of subtypes 1a (57.1%), 1b (28.6%) and 3a (14.3%). The clinical course was favorable for all HCV-infected patients, except one, who died due to renal insufficiency related to lupus nephritis. These results demonstrate a low HCV infection prevalence among the population studied. In the few positive cases, we observed no adverse influence of this infection on the clinical evolution of the rheumatic disease.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The goal of the present study was to determine concentrations of E-selectin in both cerebrospinal fluid (CSF) and serum of patients with aneurysmal subarachnoid hemorrhage (SAH) and to evaluate the correlation between the clinical parameters and E-selectin levels. Both CSF and serum samples obtained from 12 patients with aneurysmal SAH and 8 patients with hydrocephalus (control group) without any other known central nervous system disease were assayed for E-selectin by quantitative enzyme-linked immunosorbent assay and the results were compared between the two groups. Mean levels of soluble forms of E-selectin within the first 3 days and on the 5th and 7th days of SAH were 4.0 ± 7.9, 2.8 ± 5.2, and 3.1 ± 4.9 ng/ml in the patient's CSF, and 33.7 ± 9.2, 35.1 ± 7.0, and 35.2 ± 8.7 ng/ml in serum, respectively. In contrast, mean E-selectin levels were 0.1 ± 0.2 ng/ml in CSF and 8.7 ± 5.0 ng/ml in serum of control patients. The difference between groups was statistically significant regarding both CSF and serum E-selectin levels (P < 0.05). Thus, we have demonstrated a marked increase of E-selectin concentration in both CSF and serum of patients with aneurysmal SAH compared with control and suggest that blocking the interaction between E-selectin and vascular endothelium may have a beneficial effect on vasospasms.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Hepatitis C, a worldwide viral infection, is an important health problem in Brazil. The virus causes chronic infection, provoking B lymphocyte dysfunction, as represented by cryoglobulinemia, non-organ-specific autoantibody production, and non-Hodgkin's lymphoma. The aim of this research was to screen for the presence of antiphospholipid autoantibodies in 109 Brazilian hepatitis C virus carriers without clinical history of antiphospholipid syndrome. Forty healthy individuals were used as the control group. IgA, IgG, and IgM antibodies against cardiolipin and β2-glycoprotein I were measured with an enzyme-linked immunosorbent assay, using a cut-off point of either 20 UPL or 20 SBU. While 24 (22.0%) hepatitis C carriers had moderate titers of IgM anticardiolipin antibodies (median, 22.5 MPL; 95%CI: 21.5-25.4 MPL), only three carriers (<3%) had IgG anticardiolipin antibodies (median, 23 GPL; 95%CI: 20.5-25.5 GPL). Furthermore, IgA anticardiolipin antibodies were not detected in these individuals. Male gender and IgM anticardiolipin seropositivity were associated in the hepatitis C group (P = 0.0004). IgA anti-β2-glycoprotein-I antibodies were detected in 29 of 109 (27.0%) hepatitis C carriers (median, 41 SAU; 95%CI: 52.7-103.9 SAU). Twenty patients (18.0%) had IgM anti-β2-glycoprotein I antibodies (median, 27.6 SMU; 95%CI: 23.3-70.3 SMU), while two patients had IgG antibodies against this protein (titers, 33 and 78 SGU). Antiphospholipid antibodies were detected in only one healthy individual, who was seropositive for IgM anticardiolipin. We concluded that Brazilian individuals chronically infected with hepatitis C virus present a significant production of antiphospholipid antibodies, mainly IgA anti-β2-glycoprotein I antibodies, which are not associated with clinical manifestations of antiphospholipid syndrome.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Our aim was to construct a recombinant adenovirus co-expressing truncated human prostate-specific membrane antigen (tPSMA) and mouse 4-1BBL genes and to determine its effect on dendritic cells (DCs) generated from bone marrow suspensions harvested from C57BL/6 mice for which the effect of 4-1BBL on DCs is not clear, especially during DCs processing tumor-associated antigen. Replication deficient adenovirus AdMaxTM Expression System was used to construct recombinant adenovirus Ad-tPSMA-internal ribosome entry site-mouse 4-1BBL (Ad-tPSMA-IRES-m4-1BBL) and Ad-enhanced green fluorescent protein. Day 7 proliferating DC aggregates generated from C57BL/6 mice were collected as immature DCs and further mature DCs were obtained by lipopolysaccharide activated immature DCs. After DCs were exposed to the recombinant adenovirus with 250 multiplicity of infection, the expression of tPSMA and m4-1BBL proteins were detected by Western blot, and the apoptosis and phenotype of DCs were analyzed by flow cytometry. Cytokines (IL-6 and IL-12) in the supernatant were detected by enzyme-linked immunosorbent assay (ELISA). Proliferation of T cells was detected by allogeneic mixed lymphocyte reactions. The tPSMA and m4-1BBL proteins were expressed correctly. The apoptosis rate of DCs transfected with Ad-tPSMA-IRES-m4-1BBL was 14.6%, lower than that of control DCs. The expression of co-stimulatory molecules [CD80 (81.6 ± 5.4%) and CD86 (80.13 ± 2.81%)] up-regulated in Ad-tPSMA-IRES-m4-1BBL-pulsed DCs, and the level of IL-6 (3960.2 ± 50.54 pg/mL) and IL-12 (249.57 ± 12.51 pg/mL) production in Ad-tPSMA-IRES-m4-1BBL-transduced DCs were significantly higher (P < 0.05) than those in control DCs. Ad-tPSMA-IRES-m4-1BBL induced higher T-cell proliferation (OD450 = 0.614 ± 0.018), indicating that this recombinant adenovirus can effectively enhance the activity of DCs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Hypoxia inducible factor-1α (HIF-1α) is an important transcription factor, which plays a critical role in the formation of solid tumor and its microenviroment. The objective of the present study was to evaluate the expression and function of HIF-1α in human leukemia bone marrow stromal cells (BMSCs) and to identify the downstream targets of HIF-1α. HIF-1α expression was detected at both the RNA and protein levels using real-time PCR and immunohistochemistry, respectively. Vascular endothelial growth factor (VEGF) and stromal cell-derived factor-1α (SDF-1α) were detected in stromal cells by enzyme-linked immunosorbent assay. HIF-1α was blocked by constructing the lentiviral RNAi vector system and infecting the BMSCs. The Jurkat cell/BMSC co-cultured system was constructed by putting the two cells into the same suitable cultured media and conditions. Cell adhesion and secretion functions of stromal cells were evaluated after transfection with the lentiviral RNAi vector of HIF-1α. Increased HIF-1α mRNA and protein was detected in the nucleus of the acute myeloblastic and acute lymphoblastic leukemia compared with normal BMSCs. The lentiviral RANi vector for HIF-1α was successfully constructed and was applied to block the expression of HIF-1α. When HIF-1α of BMSCs was blocked, the expression of VEGF and SDF-1 secreted by stromal cells were decreased. When HIF-1α was blocked, the co-cultured Jurkat cell’s adhesion and migration functions were also decreased. Taken together, these results suggest that HIF-1α acts as an important transcription factor and can significantly affect the secretion and adhesion functions of leukemia BMSCs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effect of leptin on the progression of colorectal carcinoma to metastatic disease by analyzing the serum leptin concentration and Ob-R gene expression in colon cancer tissues. Tissue samples were obtained from 31 patients who underwent surgical resection for colon (18 cases) and metastatic colon (13 cases) cancer. Serum leptin concentration was determined by an enzyme-linked immunosorbent assay (ELISA) and Ob-R mRNA expression by real-time polymerase chain reaction (RT-PCR) for both groups. ELISA data were analyzed by the Student t-test and RT-PCR data were analyzed by the Mann-Whitney U-test. RT-PCR results demonstrated that mRNA expression of Ob-R in human metastatic colorectal cancer was higher than in local colorectal cancer tissues. On the other hand, mean serum leptin concentration was significantly higher in local colorectal cancer patients compared to patients with metastatic colorectal cancer. The results of the present study suggest a role for leptin in the progression of colon cancer to metastatic disease without weight loss. In other words, significantly increased Ob-R mRNA expression and decreased serum leptin concentration in patients with metastatic colon cancer indicate that sensitization to leptin activity may be a major indicator of metastasis to the colon tissue and the determination of leptin concentration and leptin gene expression may be used to aid the diagnosis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The mechanisms of statins relieving the no-reflow phenomenon and the effects of single-dose statins on it are not well known. This study sought to investigate the effects of inflammation on the no-reflow phenomenon in a rabbit model of acute myocardial infarction and reperfusion (AMI/R) and to evaluate the effects of single-dose atorvastatin on inflammation and myocardial no-reflow. Twenty-four New Zealand white male rabbits (5-6 months old) were randomized to three groups of eight: a sham-operated group, an AMI/R group, and an atorvastatin-treated group (10 mg/kg). Animals in the latter two groups were subjected to 4 h of coronary occlusion followed by 2 h of reperfusion. Serum levels of interleukin (IL)-6 were measured by enzyme-linked immunosorbent assay. The expression of interferon gamma (IFN-γ) in normal and infarcted (reflow and no-reflow) myocardial tissue was determined by immunohistochemical methods. The area of no-reflow and necrosis was evaluated pathologically. Levels of serum IL-6 were significantly lower in the atorvastatin group than in the AMI/R group (P<0.01). Expression of IFN-γ in infarcted reflow and no-reflow myocardial tissue was also significantly lower in the atorvastatin group than in the AMI/R group. The mean area of no-reflow [47.01% of ligation area (LA)] was significantly smaller in the atorvastatin group than in the AMI/R group (85.67% of LA; P<0.01). The necrosis area was also significantly smaller in the atorvastatin group (85.94% of LA) than in the AMI/R group (96.56% of LA; P<0.01). In a secondary analysis, rabbits in the atorvastatin and AMI/R groups were divided into two groups based on necrosis area (90% of LA): a small group (<90% of LA) and a large group (>90% of LA). There was no significant difference in the area of no-reflow between the small (61.40% of LA) and large groups (69.87% of LA; P>0.05). Single-dose atorvastatin protected against inflammation and myocardial no-reflow and reduced infarct size during AMI/R in rabbits. No-reflow was not dependent on the reduction of infarct size.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Intercellular adhesion molecule-1 (ICAM-1) is an important factor in the progression of inflammatory responses in vivo. To develop a new anti-inflammatory drug to block the biological activity of ICAM-1, we produced a monoclonal antibody (Ka=4.19×10−8 M) against human ICAM-1. The anti-ICAM-1 single-chain variable antibody fragment (scFv) was expressed at a high level as inclusion bodies in Escherichia coli. We refolded the scFv (Ka=2.35×10−7 M) by ion-exchange chromatography, dialysis, and dilution. The results showed that column chromatography refolding by high-performance Q Sepharose had remarkable advantages over conventional dilution and dialysis methods. Furthermore, the anti-ICAM-1 scFv yield of about 60 mg/L was higher with this method. The purity of the final product was greater than 90%, as shown by denaturing gel electrophoresis. Enzyme-linked immunosorbent assay, cell culture, and animal experiments were used to assess the immunological properties and biological activities of the renatured scFv.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Associations between polymorphisms of the CD36 gene and susceptibility to coronary artery heart disease (CHD) are not clear. We assessed allele frequencies and genotype distributions of CD36 gene polymorphisms in 112 CHD patients and 129 control patients using semi-quantitative polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. Additionally, we detected CD36 mRNA expression by real-time quantitative PCR, and we quantified plasma levels of oxidized low-density lipoprotein (ox-LDL) using an enzyme-linked immunosorbent assay (ELISA). There were no significant differences between the two groups (P>0.05) in allele frequencies of rs1761667 or in genotype distribution and allele frequencies of rs3173798. The genotype distribution of rs1761667 significantly differed between CHD patients and controls (P=0.034), with a significantly higher frequency of the AG genotype in the CHD group compared to the control group (P=0.011). The plasma levels of ox-LDL in patients with the AG genotype were remarkably higher than those with the GG and AA genotypes (P=0.010). In a randomized sample taken from patients in the two groups, the CD36 mRNA expression of the CHD patients was higher than that of the controls. In CHD patients, the CD36 mRNA expression in AG genotype patients was remarkably higher than in those with an AA genotype (P=0.005). After adjusted logistic regression analysis, the AG genotype of rs1761667 was associated with an increased risk of CHD (OR=2.337, 95% CI=1.336-4.087, P=0.003). In conclusion, the rs1761667 polymorphism may be closely associated with developing CHD in the Chongqing Han population of China, and an AG genotype may be a genetic susceptibility factor for CHD.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study aimed to determine the effects of different concentrations of propofol (2,6-diisopropylphenol) on lipopolysaccharide (LPS)-induced expression and release of high-mobility group box 1 protein (HMGB1) in mouse macrophages. Mouse macrophage cell line RAW264.7 cells were randomly divided into 5 treatment groups. Expression levels of HMGB1 mRNA were detected using RT-PCR, and cell culture supernatant HMGB1 protein levels were detected using enzyme-linked immunosorbent assay (ELISA). Translocation of HMGB1 from the nucleus to the cytoplasm in macrophages was observed by Western blotting and activity of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) in the nucleus was detected using ELISA. HMGB1 mRNA expression levels increased significantly in the cell culture supernatant and in cells after 24 h of stimulating RAW264.7 cells with LPS (500 ng/mL). However, HMGB1 mRNA expression levels in the P2 and P3 groups, which received 500 ng/mL LPS with 25 or 50 μmol/mL propofol, respectively, were significantly lower than those in the group receiving LPS stimulation (P<0.05). After stimulation by LPS, HMGB1 protein levels were reduced significantly in the nucleus but were increased in the cytoplasm (P<0.05). Simultaneously, the activity of NF-κB was enhanced significantly (P<0.05). After propofol intervention, HMGB1 translocation from the nucleus to the cytoplasm and NF-κB activity were inhibited significantly (each P<0.05). Thus, propofol can inhibit the LPS-induced expression and release of HMGB1 by inhibiting HMGB1 translocation and NF-κB activity in RAW264.7 cells, suggesting propofol may be protective in patients with sepsis.