Early Iron Age Pottery: A Quantitative Approach, Proceedings of the International Round Table organized by the Swiss School of Archaeology in Greece (Athens, November 28-30, 2008)

Quantitative approaches in ceramology are gaining ground in excavation reports, archaeological publications and thematic studies. Hence, a wide variety of methods are being used depending on the researchers' theoretical premise, the type of material which is examined, the context of discovery and the questions that are addressed. The round table that took place in Athens on November 2008 was intended to offer the participants the opportunity to present a selection of case studies on the basis of which methodological approaches were discussed. The aim was to define a set of guidelines for quantification that would prove to be of use to all researchers. Contents: 1) Introduction (Samuel Verdan); 2) Isthmia and beyond. How can quantification help the analysis of EIA sanctuary deposits? (Catherine Morgan); 3) Approaching aspects of cult practice and ethnicity in Early Iron Age Ephesos using quantitative analysis of a Protogeometric deposit from the Artemision (Michael Kerschner); 4) Development of a ceramic cultic assemblage: Analyzing pottery from Late Helladic IIIC through Late Geometric Kalapodi (Ivonne Kaiser, Laura-Concetta Rizzotto, Sara Strack); 5) 'Erfahrungsbericht' of application of different quantitative methods at Kalapodi (Sara Strack); 6) The Early Iron Age sanctuary at Olympia: counting sherds from the Pelopion excavations (1987-1996) (Birgitta Eder); 7) L'aire du pilier des Rhodiens à Delphes: Essai de quantification du mobilier (Jean-Marc Luce); 8) A new approach in ceramic statistical analyses: Pit 13 on Xeropolis at Lefkandi (David A. Mitchell, Irene S. Lemos); 9) Households and workshops at Early Iron Age Oropos: A quantitative approach of the fine, wheel-made pottery (Vicky Vlachou); 10) Counting sherds at Sindos: Pottery consumption and construction of identities in the Iron Age (Stefanos Gimatzidis); 11) Analyse quantitative du mobilier céramique des fouilles de Xombourgo à Ténos et le cas des supports de caisson (Jean-Sébastien Gros); 12) Defining a typology of pottery from Gortyn: The material from a pottery workshop pit, (Emanuela Santaniello); 13) Quantification of ceramics from Early Iron Age tombs (Antonis Kotsonas); 14) Quantitative analysis of the pottery from the Early Iron Age necropolis of Tsikalario on Naxos (Xenia Charalambidou); 15) Finding the Early Iron Age in field survey: Two case studies from Boeotia and Magnesia (Vladimir Stissi); 16) Pottery quantification: Some guidelines (Samuel Verdan)

Diagnostic des maladies infectieuses: place des "point of care tests" (POCT) [Use of POCT (point of care tests) in the diagnosis of infectious diseases]

Les POCT (point of care tests) ont un grand potentiel d'utilisation en médecine infectieuse ambulatoire grâce à leur rapidité d'exécution, leur impact sur l'administration d'antibiotiques et sur le diagnostic de certaines maladies transmissibles. Certains tests sont utilisés depuis plusieurs années (détection de Streptococcus pyogenes lors d'angine, anticorps anti-VIH, antigène urinaire de S. pneumoniae, antigène de Plasmodium falciparum). De nouvelles indications concernent les infections respiratoires, les diarrhées infantiles (rotavirus, E. coli entérohémorragique) et les infections sexuellement transmissibles. Des POCT, basés sur la détection d'acides nucléiques, viennent d'être introduits (streptocoque du groupe B chez la femme enceinte avant l'accouchement et la détection du portage de staphylocoque doré résistant à la méticilline). POCT have a great potential in ambulatory infectious diseases diagnosis, due to their impact on antibiotic administration and on communicable diseases prevention. Some are in use for long (S. pyogenes antigen, HIV antibodies) or short time (S. pneumoniae antigen, P. falciparum). The additional major indications will be community-acquired lower respiratory tract infections, infectious diarrhoea in children (rotavirus, enterotoxigenic E. coli), and hopefully sexually transmitted infections. Easy to use, these tests based on antigen-antibody reaction allow a rapid diagnosis in less than one hour; the new generation of POCT relying on nucleic acid detection are just introduced in practice (detection of GBS in pregnant women, carriage of MRSA), and will be extended to many pathogens

Prevalence of etravirine mutations and impact on response to treatment in routine clinical care: the Swiss HIV Cohort Study (SHCS).

OBJECTIVES: Etravirine (ETV) is a novel nonnucleoside reverse transcriptase inhibitor (NNRTI) with reduced cross-resistance to first-generation NNRTIs, which has been primarily studied in randomized clinical trials and not in routine clinical settings. METHODS: ETV resistance-associated mutations (RAMs) were investigated by analysing 6072 genotypic tests. The antiviral activity of ETV was predicted using different interpretation systems: International AIDS Society-USA (IAS-USA), Stanford, Rega and Agence Nationale de Recherches sur le Sida et les hépatites virales (ANRS). RESULTS: The prevalence of ETV RAMs was higher in NNRTI-exposed patients [44.9%, 95% confidence interval (CI) 41.0-48.9%] than in treatment-naïve patients (9.6%, 95% CI 8.5-10.7%). ETV RAMs in treatment-naïve patients mainly represent polymorphism, as prevalence estimates in genotypic tests for treatment-naïve patients with documented recent (<1 year) infection, who had acquired HIV before the introduction of NNRTIs, were almost identical (9.8%, 95% CI 3.3-21.4). Discontinuation of NNRTI treatment led to a marked drop in the detection of ETV RAMs, from 51.7% (95% CI 40.8-62.6%) to 34.5% (95% CI 24.6-45.4%, P=0.032). Differences in prevalence among subtypes were found for V90I and V179T (P<0.001). Estimates of restricted virological response to ETV varied among algorithms in patients with exposure to efavirenz (EFV)/nevirapine (NVP), ranging from 3.8% (95% CI 2.5-5.6%) for ANRS to 56.2% (95% CI 52.2-60.1%) for Stanford. The predicted activity of ETV decreased as the sensitivity of potential optimized background regimens decreased. The presence of major IAS-USA mutations (L100I, K101E/H/P and Y181C/I/V) reduced the treatment response at week 24. CONCLUSIONS: Most ETV RAMs in drug-naïve patients are polymorphisms rather than transmitted RAMs. Uncertainty regarding predictions of antiviral activity for ETV in NNRTI-treated patients remains high. The lowest activity was predicted for patients harbouring extensive multidrug-resistant viruses, thus limiting ETV use in those who are most in need.

Coronary magnetic resonance angiography in adolescents and young adults with kawasaki disease.

BACKGROUND: In patients with Kawasaki disease, serial evaluation of the distribution and size of coronary artery aneurysms (CAA) is necessary for risk stratification and therapeutic management. Although transthoracic echocardiography is often sufficient for this purpose initially, visualization of the coronary arteries becomes progressively more difficult as children grow. We sought to prospectively compare coronary magnetic resonance angiography (MRA) and x-ray coronary angiography findings in patients with CAA caused by Kawasaki disease. METHODS AND RESULTS: Six subjects (age 10 to 25 years) with known CAA from Kawasaki disease underwent coronary MRA using a free-breathing T2-prepared 3D bright blood segmented k-space gradient echo sequence with navigator gating and tracking. All patients underwent x-ray coronary angiography within a median of 75 days (range, 1 to 359 days) of coronary MRA. There was complete agreement between MRA and x-ray angiography in the detection of CAA (n=11), coronary artery stenoses (n=2), and coronary occlusions (n=2). Excellent agreement was found between the 2 techniques for detection of CAA maximal diameter (mean difference=0.4 +/- 0.6 mm) and length (mean difference=1.4 +/- 1.6 mm). The 2 methods showed very similar results for proximal coronary artery diameter (mean difference=0.2 +/- 0.5 mm) and CAA distance from the ostia (mean difference=0.1 +/- 1.5 mm). CONCLUSION: Free-breathing 3D coronary MRA accurately defines CAA in patients with Kawasaki disease. This technique may provide a non-invasive alternative when transthoracic echocardiography image quality is insufficient, thereby reducing the need for serial x-ray coronary angiography in this patient group.

Seismic detection and characterization of landslides and other mass movements

Seismic methods used in the study of snow avalanches may be employed to detect and characterize landslides and other mass movements, using standard spectrogram/sonogram analysis. For snow avalanches, the spectrogram for a station that is approached by a sliding mass exhibits a triangular time/frequency signature due to an increase over time in the higher-frequency constituents. Recognition of this characteristic footprint in a spectrogram suggests a useful metric for identifying other mass-movement events such as landslides. The 1 June 2005 slide at Laguna Beach, California is examined using data obtained from the Caltech/USGS Regional Seismic Network. This event exhibits the same general spectrogram features observed in studies of Alpine snow avalanches. We propose that these features are due to the systematic relative increase in high-frequency energy transmitted to a seismometer in the path of a mass slide owing to a reduction of distance from the source signal. This phenomenon is related to the path of the waves whose high frequencies are less attenuated as they traverse shorter source-receiver paths. Entrainment of material in the course of the slide may also contribute to the triangular time/frequency signature as a consequence of the increase in the energy involved in the process; in this case the contribution would be a source effect. By applying this commonly observed characteristic to routine monitoring algorithms, along with custom adjustments for local site effects, we seek to contribute to the improvement in automatic detection and monitoring methods of landslides and other mass movements.

Recommendations for the use of ultrasound in rheumatoid arthritis: literature review and SONAR score experience.

Ultrasound (US) has become a useful tool in the detection of early disease, differential diagnosis, guidance of treatment decisions and treatment monitoring of rheumatoid arthritis (RA). In 2008, the Swiss Sonography in Arthritis and Rheumatism (SONAR) group was established to promote the use of US in inflammatory arthritis in clinical practice. A scoring system was developed and taught to a large number of Swiss rheumatologists who already contributed to the Swiss Clinical Quality Management (SCQM) database, a national patient register. This paper intends to give a Swiss consensus about best clinical practice recommendations for the use of US in RA on the basis of the current literature knowledge and experience with the Swiss SONAR score. Literature research was performed to collect data on current evidence. The results were discussed among specialists of the Swiss university centres and private practice, following a structured procedure. Musculoskelatal US was found to be very helpful in establishing the diagnosis and monitoring the evolution of RA, and to be a reliable tool if used by experienced examiners. It influences treatment decisions such as continuing, intensifying or stepping down therapy. The definite modalities of integrating US into the diagnosis and monitoring of RA treatments will be defined within a few years. There are, however, strong arguments to use US findings as of today in daily clinical care. Some practical recommendations about the use of US in RA, focusing on the diagnosis and the use of the SONAR score, are proposed.

A detailed urinary excretion time course study of captan and folpet biomarkers in workers for the estimation of dose, main route-of-entry and most appropriate sampling and analysis strategies

Captan and folpet are two fungicides largely used in agriculture, but biomonitoring data are mostly limited to measurements of captan metabolite concentrations in spot urine samples of workers, which complicate interpretation of results in terms of internal dose estimation, daily variations according to tasks performed, and most plausible routes of exposure. This study aimed at performing repeated biological measurements of exposure to captan and folpet in field workers (i) to better assess internal dose along with main routes-of-entry according to tasks and (ii) to establish most appropriate sampling and analysis strategies. The detailed urinary excretion time courses of specific and non-specific biomarkers of exposure to captan and folpet were established in tree farmers (n = 2) and grape growers (n = 3) over a typical workweek (seven consecutive days), including spraying and harvest activities. The impact of the expression of urinary measurements [excretion rate values adjusted or not for creatinine or cumulative amounts over given time periods (8, 12, and 24 h)] was evaluated. Absorbed doses and main routes-of-entry were then estimated from the 24-h cumulative urinary amounts through the use of a kinetic model. The time courses showed that exposure levels were higher during spraying than harvest activities. Model simulations also suggest a limited absorption in the studied workers and an exposure mostly through the dermal route. It further pointed out the advantage of expressing biomarker values in terms of body weight-adjusted amounts in repeated 24-h urine collections as compared to concentrations or excretion rates in spot samples, without the necessity for creatinine corrections.

Maturity of Concrete: Field Implementation, MLR-96-1, 1996

The result and experience of field implementation of the maturity method on 14 portland cement concrete (PCC) paving and patching projects during 1995 are summarized in this report. The procedure for developing reference PCC maturity-strength curve of concrete is discussed. Temperature measurement as well as effects of datum temperature, entrained air content and type of aggregate on maturity-strength relationship are examined. Some limitations of the maturity method are discussed. The available field experience and results indicate that the maturity method provides a simple approach to determine strength of concrete, and can be easily implemented in field paving and patching projects. The use of the maturity method may result in reduced project construction time.

Perceptions of diabetes obtained through drawing in childhood and adolescence

Objective: To examine whether drawing is useful in the detection of problems of psychosocial adaptation in children and adolescents with type 1 diabetes (T1D) and in improving communication with health professionals. Methods: We performed an exploratory descriptive study in 199 children and adolescents with T1D aged 413 years. The participants were asked to render a drawing on a suggested topic. The variables analyzed were related to the drawing and to clinical and sociodemographic data. Results: Most participants showed evidence of having a well-balanced personality, but there were also signs of affective or psychosocial difficulties. Conclusion: Drawing is a useful technique by which to identify children"s and adolescents" feelings and possible problems in adapting to T1D, as well as to gain information directly from the children themselves. Future studies should delimit the possibilities of this technique in clinical practice in greater detail.

Perceptions of diabetes obtained through drawing in childhood and adolescence

Objective: To examine whether drawing is useful in the detection of problems of psychosocial adaptation in children and adolescents with type 1 diabetes (T1D) and in improving communication with health professionals. Methods: We performed an exploratory descriptive study in 199 children and adolescents with T1D aged 413 years. The participants were asked to render a drawing on a suggested topic. The variables analyzed were related to the drawing and to clinical and sociodemographic data. Results: Most participants showed evidence of having a well-balanced personality, but there were also signs of affective or psychosocial difficulties. Conclusion: Drawing is a useful technique by which to identify children"s and adolescents" feelings and possible problems in adapting to T1D, as well as to gain information directly from the children themselves. Future studies should delimit the possibilities of this technique in clinical practice in greater detail.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Multiple mating and offspring quality in Lasius ants

Genetic diversity benefits for social insect colonies headed by polyandrous queens have received intense attention, whereas sexual selection remains little explored. Yet mates of the same queen may engage in sperm competition over the siring of offspring, and this could confer benefits on queens if the most successful sire in each colony (the majority sire) produces gynes (daughter queens) of higher quality. These benefits could be increased if high-quality sires make queens increase the percentage of eggs that they fertilize (unfertilized eggs develop into sons in social hymenopterans), or if daughters of better genetic quality are over-represented in the gyne versus worker class. Such effects would lead to female-biased sex ratios in colonies with high-quality majority gynes. I tested these ideas in field colonies of Lasius niger black garden ants, using body mass of gynes as a fitness trait as it is known to correlate with future fecundity. Also, I established the paternity of gynes through microsatellite DNA offspring analyses. Majority sires did not always produce heavier gynes in L. niger, but whenever they did do so colonies produced more females, numerically and in terms of the energetic investment in female versus male production. Better quality sires may be able to induce queens to fertilize more eggs or so-called caste shunting may occur wherever the daughters of better males are preferentially shunted to into the gyne caste. My study supports that integrating sexual selection and social evolutionary studies may bring a deeper understanding of mating system evolution in social insects.

Defining molecular components of symbiotic phosphate uptake in rice

Phosphate (Pi) acquisition of crops via arbuscular mycorrhizal (AM) symbiosis acquires increasing importance due to the limited rock Pi reserves and the demand for environmentally sustainable agriculture. However, the symbiotic Pi uptake machinery has not been characterized in any monocotyledonous plant species. Among these, rice is the primary staple food for more than half of the human population and thus central for future food security. However, the relevance of the AM symbiosis for rice Pi nutrition is presently unclear. Here, we show that 70% of the overall Pi acquired by rice is delivered via the symbiotic route. To better understand this pathway we combined genetic, molecular and physiological approaches to determine the specific functions of the two rice Pi transporters, PT11 and PT13, which are expressed only during AM symbiosis. The PT11 lineage of proteins is present in mono- and dicotyledons whereas PT13, while found across the Poaceae, is absent from dicotyledons. Surprisingly, mutations in either PT11 or PT13 affected fungal colonization and arbuscule formation demonstrating that both genes are essential for AM symbiosis between rice and Glomus intra.rad.ices. Importantly, for symbiotic Pi uptake, only PT11 is necessary and sufficient. We found that mycorrhizal rice, remarkably, received almost all Pi via the symbiotic route. Such dominating mycorrhizal Pi uptake was found in plants grown under controlled conditions as well as in field soils, suggesting that the AM symbiosis is relevant for the Pi nutrition of field grown rice. Development of smaller arbuscules in PT11 mutants suggested that symbiotic Pi signaling is required for fungal nourishment by the plant. However, co-culture of mutant with wild type nurse plants did not restore normal arbuscule size in mutant roots, indicating that other factors than malnutrition accounted for the altered arbuscule phenotype. Surprisingly, the loss of PT13 did not affect symbiotic Pi uptake although it impacted arbuscule morphology, suggesting that PT13 is involved in signaling during arbuscule development. However, induction of PT13 was not only monitored in arbusculated cells but also in inner cortex cells of non-inoculated roots of plants grown under high Pi fertilization conditions. According to preliminary observations, PT13 localized at the tonoplast in arbusculated and non-arbusculated cells, suggesting that it might be involved in transporting Pi into the vacuole, possibly for maintaining cellular Pi homeostasis. The further investigation showed that fungal colonization level was significantly affected in the crown roots of two ptlS mutant alleles, but not in large lateral roots, implying the possible role of PT13 for maintaining Pi homeostasis in the crown roots. - L'acquisition de phosphate (Pi) par les plantes cultivées s'effectue grâce à une symbiose mycorhizienne arbasculaire (AM). L'étude de cette symbiose devient fondamentale puisque d'une part, les réserves en phosphate minéral sont limitées, et, d'autre part, la demande pour une agriculture écologiquement soutenable se renforce. La machinerie d'absorption symbiotique du phosphate n'est cependant pas encore élucidée chez les plantes monocotylédones. Parmi celles-ci, le riz occupe une place primordiale. Aliment de base pour plus de la moitié de la population mondiale, il revêt de ce fait une dimension essentielle en termes de sécurité alimentaire. Pourtant, l'importance de la symbiose AM chez le riz dans le processus d'acquisition du phosphate n'est, encore de nos jours, que peu comprise. Dans cette étude, nous montrons que 70% du phosphate acquis par le riz est mis à disposition de la plante grâce à la symbiose AM. Afin de mieux comprendre ce mécanisme, nous avons employé des approches physiologiques et génétiques nous permettant de déterminer les fonctions spécifiques de deux transporteurs de Pi, PT11 et PT13, présents chez le riz et exprimés uniquement durant la symbiose AM. La famille de gènes à laquelle appartient PT11 est présente chez les monocotylédones ainsi que chez les dicotylédones tandis que PT13, bien que retrouvé au sein des Poaceae, est absent chez les dicotylédones. Etonnamment, des versions mutées de PT11 ou de PT13 affectent la colonisation par le champignon endo-mycorhizien ainsi que la formation d'arbuscules, démontrant l'importance de ces deux gènes dans la symbiose AM entre le riz et Glomus intraradices. Il est à noter que seul PT11 se révèle nécessaire et suffisant pour l'apport de Pi grâce à la symbiose. Nous avons observé que la presque totalité du phosphate dont dispose le riz lors d'une symbiose AM provient du champignon. De telles proportions ont été observées tant chez des plantes cultivées en conditions contrôlées que chez des plantes cultivées dans les champs. Cela suggère l'importance de la symbiose AM dans le processus d'acquisition du Pi chez le riz cultivé à l'extérieur. Le développement d'arbuscules plus petits chez le mutant PT11 tend à montrer qu'une voie signalétique impliquant le Pi symbiotique est nécessaire pour l'entretien du champignon par la plante. Toutefois, une co-culture du mutant avec des plantes sauvages ne permet pas de restaurer des arbuscules de taille normale dans les racines du mutant. Ce résultat indique le rôle de facteurs autres que la malnutrition aboutissant à la formation d'arbuscules altérés. Si la perte de PT13 n'affecte pas l'acquisition de phosphate symbiotique, la morphologie de l'arbuscule est, quant à elle, modifiée. Ceci suggère un rôle de PT13 durant le développement de l'arbuscule. Or, l'induction de PT13 est non seulement détectée dans des cellules contenant des arbuscules mais également dans des cellules du cortex, ceci chez des plantes cultivées sans champignon mais dans des conditions de fortes concentrations en engrais phosphaté. En accord avec des observations précédentes, PT13 est localisé au niveau du tonoplaste des cellules contenant ou non des arbuscules. Ceci suggère que PT13 pourrait être impliqué dans le transport du Pi vers la vacuole, éventuellement pour maintenir une certaine homéostasie du phosphate. Dans cette étude, nous démontrons également que le niveau de colonisation par le champignon est affecté de manière significative dans les racines principales des deux allèles du mutants ptl3, mais pas dans les grosses racines latérales. Cela impliquerait un rôle possible de PT13 dans le maintien de l'homéostasie du phosphate dans les racines principales. RESUME POUR UN LARGE PUBLIC Le phosphate (Pi), l'un des éléments minéraux essentiel au développement des plantes, se trouve généralement en faible quantité dans le sol, limitant ainsi la croissance des plantes. Le rendement de la production agricole dépend dès lors de l'addition d'engrais contenant du phosphate inorganique (Pi), obtenu à partir de ressources minières riches en phosphate. Or, ces ressources devraient être épuisées d'ici la fin du siècle. Les racines des plantes possèdent des transporteurs de phosphate efficaces leur permettant d'acquérir rapidement le Pi présent dans le sol. Comme le Pi s'avère immobile dans le sol, l'absorption rapide par les racines crée des zones pauvres en Pi autour des systèmes racinaires. Pour surmonter cet obstacle, les plantes ont développé une symbiose avec des champignons endomycorhiziens, la symbiose mycorhizienne arbusculaire (AM). Cette association leur donne accès à d'autres ressources en phosphate puisque le mycélium de ces champignons se développe sur une surface 100 fois supérieure à celle des racines. Cela augmente considérablement la surface de nutrition, dépassant ainsi la zone appauvrie en Pi. Le phosphate, transporté grâce au champignon jusqu'à l'intérieur des racines, est fourni à la plante par le biais de structures établies à l'intérieur des cellules végétales, appelées arbuscules. De leur côté, les plantes possèdent des transporteurs spécifiques afin de recevoir le Pi fourni par les champignons. A l'heure actuelle, la machinerie nécessaire à cette absorption a été uniquement décrite chez des plantes dicotylédones. Or, comprendre l'apport de phosphate par les champignons mycorhiziens s'avère particulièrement pertinent dans le cas des espèces monocotylédones cultivées telles que les céréales. Ces dernières constituent en effet la majeure partie de l'alimentation humaine. Parmi les céréales, le riz demeure l'aliment de base de la population mondiale, d'où son importance en terme de sécurité alimentaire. Durant mon travail de thèse, j'ai identifié et caractérisé le transporteur du riz impliqué dans l'apport de phosphate par ce type de symbiose AM. J'ai également démontré que le riz, lorsqu'il vit en symbiose, bénéficie de la presque totalité du Pi transporté par le champignon. Environ 40% de la production globale de riz est cultivée dans des conditions permettant la symbiose avec des mycorhizes arbusculaires. Les variétés de riz adaptées à ces conditions aérobiques deviennent des alternatives favorables aux cultivars actuels nécessitant une forte irrigation. Elles se révèlent en effet plus tolérantes aux pénuries d'eau et permettent l'utilisation de pratiques agricoles moins intensives. Les données présentées dans cette étude enrichissent nos connaissances concernant l'absorption du phosphate chez le riz grâce à la symbiose AM. Ces connaissances peuvent s'avérer décisives pour le développement de cultivars du riz plus adaptés à une agriculture écologiquement soutenable.

A multicentre, retrospective case-control study assessing the role of trabecular bone score (TBS) in menopausal Caucasian women with low areal bone mineral density (BMDa): Analysing the odds of vertebral fracture.

INTRODUCTION: The trabecular bone score (TBS) is a new parameter that is determined from grey level analysis of DXA images. It relies on the mean thickness and volume fraction of trabecular bone microarchitecture. This was a preliminary case-control study to evaluate the potential diagnostic value of TBS, both alone and combined with bone mineral density (BMDa), in the assessment of vertebral fracture. METHODS: Out of a subject pool of 441 Caucasian, postmenopausal women between the ages of 50 and 80 years, we identified 42 women with osteoporosis-related vertebral fractures, and compared them with 126 age-matched women without any fractures (1 case: 3 controls). Primary outcomes were BMDa and TBS. Inter-group comparisons were undertaken using Student's t-tests and Wilcoxon signed ranks tests for parametric and non-parametric data, respectively. Odds ratios for vertebral fracture were calculated for each incremental one standard deviation decrease in BMDa and TBS, and areas under the receiver operating curve (AUC) calculated and sensitivity analysis were conducted to compare BMDa alone, TBS alone, and the combination of BMDa and TBS. Subgroup analyses were performed specifically for women with osteopenia, and for women with T-score-defined osteoporosis. RESULTS: Across all subjects (n=42, 126) weight and body mass index were greater and BMDa and TBS both less in women with fractures. The odds of vertebral fracture were 3.20 (95% CI, 2.01-5.08) for each incremental decrease in TBS, 1.95 (1.34-2.84) for BMDa, and 3.62 (2.32-5.65) for BMDa + TBS combined. The AUC was greater for TBS than for BMDa (0.746 vs. 0.662, p=0.011). At iso-specificity (61.9%) or iso-sensitivity (61.9%) for both BMDa and TBS, TBS + BMDa sensitivity or specificity was 19.1% or 16.7% greater than for either BMDa or TBS alone. Among subjects with osteoporosis (n=11, 40) both BMDa (p=0.0008) and TBS (p=0.0001) were lower in subjects with fractures, and both OR and AUC (p=0.013) for BMDa + TBS were greater than for BMDa alone (OR=4.04 [2.35-6.92] vs. 2.43 [1.49-3.95]; AUC=0.835 [0.755-0.897] vs. 0.718 [0.627-0.797], p=0.013). Among subjects with osteopenia, TBS was lower in women with fractures (p=0.0296), but BMDa was not (p=0.75). Similarly, the OR for TBS was statistically greater than 1.00 (2.82, 1.27-6.26), but not for BMDa (1.12, 0.56-2.22), as was the AUC (p=0.035), but there was no statistical difference in specificity (p=0.357) or sensitivity (p=0.678). CONCLUSIONS: The trabecular bone score warrants further study as to whether it has any clinical application in osteoporosis detection and the evaluation of fracture risk.

Evaluation of Steel Bridges, Volumes I & II, TR-493, 2007

This report is divided into two volumes. This volume (Volume I) summarizes a structural health monitoring (SHM) system that was developed for the Iowa DOT to remotely and continuously monitor fatigue critical bridges (FCB) to aid in the detection of crack formation. The developed FCB SHM system enables bridge owners to remotely monitor FCB for gradual or sudden damage formation. The SHM system utilizes fiber bragg grating (FBG) fiber optic sensors (FOSs) to measure strains at critical locations. The strain-based SHM system is trained with measured performance data to identify typical bridge response when subjected to ambient traffic loads, and that knowledge is used to evaluate newly collected data. At specified intervals, the SHM system autonomously generates evaluation reports that summarize the current behavior of the bridge. The evaluation reports are collected and distributed to the bridge owner for interpretation and decision making. Volume II summarizes the development and demonstration of an autonomous, continuous SHM system that can be used to monitor typical girder bridges. The developed SHM system can be grouped into two main categories: an office component and a field component. The office component is a structural analysis software program that can be used to generate thresholds which are used for identifying isolated events. The field component includes hardware and field monitoring software which performs data processing and evaluation. The hardware system consists of sensors, data acquisition equipment, and a communication system backbone. The field monitoring software has been developed such that, once started, it will operate autonomously with minimal user interaction. In general, the SHM system features two key uses. First, the system can be integrated into an active bridge management system that tracks usage and structural changes. Second, the system helps owners to identify damage and deterioration.