Copper(II) complexes of tetradentate N2S2 donor sets: synthesis, crystal structure characterization and reactivity

Two mononuclear and one dinuclear copper(II) complexes, containing neutral tetradentate NSSN type ligands, of formulation [Cu-II(L-1)Cl]ClO4 (1), [Cu-II(L-2)Cl]ClO4 (2) and [Cu-2(II)(L-3)(2)Cl-2](ClO4)(2) (3) were synthesized and isolated in pure form [where L-1 = 1,2-bis(2-pyridylmethylthio)ethane, L-2 = 1,3-bis(2-pyridylmethylthio)propane and L-3 = 1,4-bis(2-pyridylmethylthio)butane]. All these green colored copper(II) complexes were characterized by physicochemical and spectroscopic methods. The dinuclear copper(II) complex 3 changed to a colorless dinuclear copper(I) species of formula [Cu-2(1)(L-3)(2)](ClO4)(2),0.5H(2)O (4) in dimethylformamide even in the presence of air at ambient temperature, while complexes I and 2 showed no change under similar conditions. The solid-state structures of complexes 1, 2 and 4 were established by X-ray crystallography. The geometry about the copper in complexes 1 and 2 is trigonal bipyramidal whereas the coordination environment about the copper(I) in dinuclear complex 4 is distorted tetrahedral. (C) 2008 Elsevier Ltd. All rights reserved.

Synthesis, crystal structure and reactivity of copper(II) complexes of tetradentate N2S2 donor ligands

Two new hexa-coordinated mononuclear copper(II) complexes of two ligands L-1 and L-2 containing NSSN donor sets formulated as [Cu(L)(H2O)(2)](NO3)(2) [1a, L = 1,2-bis(2-pyridylmethylthio)ethane (L-1), 1b L = 1,3-bis(2-pyridyl-methylthio)propane (L-2)] were synthesized and characterized by physico-chemical and spectroscopic methods. In 1a the single crystal X-ray crystallography analysis showed a distorted octahedral geometry about copper(II) ion. The crystal packing evidences pairs of complexes arranged about a center of symmetry and connected through a H-bond occurring between aquo ligands and nitrate anions. On reaction with chloride and pseudohalides (N-3(-) and SCN-), in acetonitrile at ambient temperature. complexes 1 changed to monocationic penta-coordinated mononuclear copper(H) species formulated as [Cu(L)(Cl)]NO3 (2), [Cu(L)(N-3)]NO3 (3). and [Cu(L)(SCN)]NO3 (4). These copper(II) complexes have been isolated in pure form from the reaction mixtures and characterized by physico-chemical and spectroscopic tools. The solid-state structure of 2a, established by X-ray crystallography, shows a trigonal bipyramidal geometry about the metal ion with a trigonality index (tau) of 0.561. (C) 2009 Elsevier B.V. All rights reserved.

Synthesis and structural characterization of two nostoclide analogues

The vinylogous aldol reaction between appropriate aldehydes and furan-based silyloxy diene synthon generated from 3-benzyl-5H-furan-2-one (3) afforded two truncated lactone analogues [compounds (4) and (5)] of nostoclides (2). The compounds were fully characterized by IR, NMR (H-1 and C-13), 2D NMR spectroscopy experiments (HMBC, HSQC and NOESY), MS spectrometry and X-ray crystallography. Compounds (4) and (5) crystallized in the space group P2(1)2(1)2(1) and P2(1)/c, respectively. Although expected correlations between hydrogen atoms in spatial close proximity were not observed for compound (5) using NMR, the stereochemistry of the exocyclic double bond of both (4) and (5) was unambiguously determined to be Z and E, respectively, using X-ray crystallography. The packing of both compounds within the crystal are stabilized by non-classical inter-molecular hydrogen bonds. DFT calculations (B3LYP/6-31+G* level) confirmed that the crystal structures possessed the lowest energies in the gas phase when compared to their geometric isomers. (c) 2006 Elsevier B.V. All rights reserved.

Metallo-organic domino reactions: C-H versus C-C bond breaking

HL and MeL are prepared by condensing benzil dihydrazone with 2-formylpyridine and 2-acetylpyridine, respectively, in 1:2 molar proportions. While in a reaction with [Ru-(C6H6)Cl-2](2), HL yields the cation [Ru(C6H6){5,6-diphenyl-3-(pyridin-2-yl)- 1,2,4-triazine}Cl](+), MeL gives the cation [Ru(C6H6)(MeL)Cl](+). Both the cations are isolated as their hexafluorophosphate salts and characterised by X-ray crystallography. In the case of HL, double domino electrocyclic/elimination reactions are found to occur. The electrocyclic reaction occurs in a C=N-N=C-C=N fragment of HL and the elimination reaction involves breaking of a C-H bond of HL. Density functional calculations on model complexes indicate that the identified electrocyclic reaction is thermochemically as well as kinetically feasible for both HL and MeL in the gas phase. For a double domino reaction, similar to that operative in HL, to occur for MeL, breaking of a C-C bond would be required in the elimination step. Our model calculations show the energy barrier for this elimination step to be much higher (329.1 kJ mol(-1)) for MeL than that for HL (96.3 kJ mol(-1)). Thus, the domino reaction takes place for HL and not for MeL. This accounts for the observed stability of [Ru(C6H6)-(MeL)Cl](+) under the reaction conditions employed.

Transition metal-directed self-assembly of calix[4]arene based dithiocarbamate ligands

The transition metal-directed self-assembly of dithiocarbamate ligand functionalised upper and lower rim calix[4]arenes affords novel dimeric bimetallic bis(calix[4]arene) species as determined by a combination of analytical methods including X-ray crystallography. An exception is a zinc(II) dithiocarbamate upper rim calix[4]arene assembly which is monomeric in nature. Electrochemical investigations reveal the bimetallic copper(II) bis(calix[4]arene) systems can electrochemically sense dihydrogen phosphate and carboxylate anions via significant cathodic perturbations of the respective copper(II)/(III) dithiocarbamate oxidation wave.

Heteroaryl substituted titanocenes as potential anti-cancer drugs

From the reaction of Super Hydride (LiBEt3H) with 6-(furyl)fulvene (1a), 6-(thiophenyl)fulvene (1b) or 6-(N-methyl-pyrrole)fulvene (1c) the corresponding lithium cyclopentadienide intermediates (2a-c) were obtained. These intermediates were reacted with titanium tetrachloride and bis-[(furyl-2-cyclopentadienylmethane)] titanium(IV) dichloride (3a) and bis-[(thiophenyl-2-cyclopentadienylmethane)] titanium(IV) dichloride (3b) and bis-[(N-methylpyrrole-2-cyclopentadienylmethane)] titanium(IV) dichloride (3c) were obtained and subsequently characterised by X-ray crystallography. When titanocenes 3a-c were tested against pig kidney (LLC-PK) cells inhibitory concentrations (IC50) of 1.6 x 10(-4) M, 1.5 x 10(-4) M and 9.1 x 10(-5) M, respectively, were observed. These values represent improved cytotoxicity against LLC-PK, when compared to their corresponding ansa substituted analogues and also in comparison to unsubstituted titanocene dichloride. (c) 2006 Elsevier Inc. All rights reserved.

ExtSym: a program to aid space-group determination from powder diffraction data

Once unit-cell dimensions have been determined from a powder diffraction data set and therefore the crystal system is known (e.g. orthorhombic), the method presented by Markvardsen, David, Johnson & Shankland [Acta Cryst. (2001), A57, 47-54] can be used to generate a table ranking the extinction symbols of the given crystal system according to probability. Markvardsen et al. tested a computer program (ExtSym) implementing the method against Pawley refinement outputs generated using the TF12LS program [David, Ibberson & Matthewman (1992). Report RAL-92-032. Rutherford Appleton Laboratory, Chilton, Didcot, Oxon, UK]. Here, it is shown that ExtSym can be used successfully with many well known powder diffraction analysis packages, namely DASH [David, Shankland, van de Streek, Pidcock, Motherwell & Cole (2006). J. Appl. Cryst. 39, 910-915], FullProf [Rodriguez-Carvajal (1993). Physica B, 192, 55-69], GSAS [Larson & Von Dreele (1994). Report LAUR 86-748. Los Alamos National Laboratory, New Mexico, USA], PRODD [Wright (2004). Z. Kristallogr. 219, 1-11] and TOPAS [Coelho (2003). Bruker AXS GmbH, Karlsruhe, Germany]. In addition, a precise description of the optimal input for ExtSym is given to enable other software packages to interface with ExtSym and to allow the improvement/modification of existing interfacing scripts. ExtSym takes as input the powder data in the form of integrated intensities and error estimates for these intensities. The output returned by ExtSym is demonstrated to be strongly dependent on the accuracy of these error estimates and the reason for this is explained. ExtSym is tested against a wide range of data sets, confirming the algorithm to be very successful at ranking the published extinction symbol as the most likely. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved.

Cytenamide trifluoroacetic acid solvate

Cytenamide forms a 1:1 solvate with trifluoroacetic acid (systematic name: 5H-dibenzo[a, d] cycloheptatriene-5-carboxamide trifluoroacetic acid solvate), C16H13NO center dot C2HF3O2. The compound crystallizes with one molecule of cytenamide and one of trifluoroacetic acid in the asymmetric unit; these are linked by O-H center dot center dot center dot O and N-H center dot center dot center dot O hydrogen bonds to form an R-2(2)(8) motif. The trifluoromethyl group of the solvent molecule displays rotational disorder over two sites, with site-occupancy factors of 0.964 (4) and 0.036 (4).

Cytenamide acetic acid solvate

In the crystal structure of the title compound (systematic name: 5H-dibenzo[a,d]cycloheptatriene-5-carboxamide ethanoic acid solvate), C16H13NO center dot C2H4O2, the cytenamide and solvent molecules form a hydrogen-bonded R-2(2)(8) dimer motif, which is further connected to form a centrosymmetric double ring motif arrangement. The cycloheptene ring adopts a boat conformation and the dihedral angle between the least-squares planes through the two aromatic rings is 54.7 (2)degrees.

Cytenamide-butyric acid (1/1)

Cytenamide forms a 1:1 solvate with butyric acid [systematic name: 5H-dibenzo[a,d]cycloheptatriene-5-carboxamide-butanoic acid (1/1)], C16H13NO center dot C4H8O2. The title compound crystallizes with one molecule of cytenamide and one of butyric acid in the asymmetric unit; these molecules are linked by N-H center dot center dot center dot O and O-H center dot center dot center dot O hydrogen bonds to form an R-2(2)(8) heterodimer motif. Pairs of adjacent motifs are further connected via N-H center dot center dot center dot O interactions to form a discrete centrosymmetric assembly.

Cytenamide-1,4-dioxane (2/1)

In the crystal structure of the title compound [systematic name: 5H-dibenzo[a,d]cycloheptatriene-5-carboxamide-1,4dioxane(2/1)], 2C(16)H(13)NO center dot C4H8O2, the cytenamide molecules form a hydrogen-bonded R-2(2)(8) dimer. The solvent molecule is located between two adjacent cytenamide dimers and forms N-H center dot center dot center dot O hydrogen bonds with one cytenamide molecule from each dimer.

A differential thermal expansion approach to crystal structure determination from powder diffraction data

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Urea-N,N-dimethylacetamide (1/1)

Urea forms a 1:1 solvate with N,N-dimethylacetamide (DMA) [systematic name: diaminomethanal- N,N-dimethylacetamide (1/1), C4H9NO center dot CH4N2O] with both molecules positioned on a twofold axis, giving rise to rotational disorder of the DMA molecule. The molecules display a layered structure in which urea molecules form hydrogen-bonded ribbons bounded by molecules of solvent.

Comparative genome analysis provides insights into the evolution and adaptation of Pseudomonas syringae pv. aesculi on Aesculus hippocastanum.

A recently emerging bleeding canker disease, caused by Pseudomonas syringae pathovar aesculi (Pae), is threatening European horse chestnut in northwest Europe. Very little is known about the origin and biology of this new disease. We used the nucleotide sequences of seven commonly used marker genes to investigate the phylogeny of three strains isolated recently from bleeding stem cankers on European horse chestnut in Britain (E-Pae). On the basis of these sequences alone, the E-Pae strains were identical to the Pae type-strain (I-Pae), isolated from leaf spots on Indian horse chestnut in India in 1969. The phylogenetic analyses also showed that Pae belongs to a distinct clade of P. syringae pathovars adapted to woody hosts. We generated genome-wide Illumina sequence data from the three E-Pae strains and one strain of I-Pae. Comparative genomic analyses revealed pathovar-specific genomic regions in Pae potentially implicated in virulence on a tree host, including genes for the catabolism of plant-derived aromatic compounds and enterobactin synthesis. Several gene clusters displayed intra-pathovar variation, including those encoding type IV secretion, a novel fatty acid biosynthesis pathway and a sucrose uptake pathway. Rates of single nucleotide polymorphisms in the four Pae genomes indicate that the three E-Pae strains diverged from each other much more recently than they diverged from I-Pae. The very low genetic diversity among the three geographically distinct E-Pae strains suggests that they originate from a single, recent introduction into Britain, thus highlighting the serious environmental risks posed by the spread of an exotic plant pathogenic bacterium to a new geographic location. The genomic regions in Pae that are absent from other P. syringae pathovars that infect herbaceous hosts may represent candidate genetic adaptations to infection of the woody parts of the tree.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.