Mannose-binding lectin gene polymorphism and resistance to therapy in women with recurrent vulvovaginal candidiasis

Precis Women with recurrent vulvovaginal candidiasis (RVC) due to a polymorphism in codon 54 of the MBL2 gene respond better to fluconazole maintenance therapy than do women with other underlying causes. Objective To explain differences in response rates to maintenance therapy with fluconazole in women suffering from RVC by evaluating associations with a polymorphism in the gene coding for mannose-binding lectin (MBL). Design Follow-up study, neted case-control group. Setting Women attending vulvoginitis clinic for RVC. Population Women participating in a multicentric study in Belgium with a degressive dose of fluconazole for RVC (the ReCiDiF trial) were divided into good responders, intermediate responders and nonresponders according to the number of relapses they experienced during therapy. From 109 of these women with adequate follow-up data, vaginal lavage with 2 ml of saline were performed at the moment of a proven acute attack at inclusion in the study, before maintenance treatment was started. A buccal swab was obtained from 55 age-matched women without a history of Candida infections, serving as a control group. Methods Extracted DNA from buccal or vaginal cells was tested for codon 54 MBL2 gene polymorphism by polymerase chain reaction and endonuclease digestion. Main outcome measures Frequency of MBL2 condon 54 allele B in women with optimal or poor response to maintenance therapy in composition with controls. Results Women (n = 109) suffering from RVC were more likely to carry the variant MBL2 codon 54 allele B than control women (20 versus 6.6%, OR 3.4 [95% CI 1.3-8.2], P = 0.01). B alleles were present in 25% of the 36 women not suffering from any recurrence during the maintenance therapy with decreasing doses of fluconazole (OR 4.9 [95% CI 1.9-12.5], P = 0.0007 versus controls), in 20% of the 43 women with sporadic recurrences (OR 3.6 [95% CI 1.4-9.2], P = 0.007 versus controls) and in 15% of the 30 women who had to interrupt the treatment regimen due to frequent relapses (P = 0.097 versus controls). Conclusions The MBL2 codon 54 gene polymorphism is more frequent in Belgian women suffering from RVC than in controls. The presence of the B allele is associated with a superior response to fluconazole maintenance therapy as compared with RVC patients without this polymorphism. We conclude that RVC due to deficient MBL production is more easily helped with antifungal medication than is RVC due to some other mechanism.

Insertion/deletion polymorphism of the angiotensin converting enzyme gene and loss of the insertion allele in aldosterone-producing adenoma

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

Reconstruction of large cranial defects in nonimmunosuppressed experimental design with human dental pulp stem cells

The main aim of this study is to evaluate the capacity of human dental pulp stem cells (hDPSC), isolated from deciduous teeth, to reconstruct large-sized cranial bone defects in nonimmunosuppressed (NIS) rats. To our knowledge, these cells were not used before in similar experiments. We performed two symmetric full-thickness cranial defects (5 x 8 mm) on each parietal region of eight NIS rats. In six of them, the left side was supplied with collagen membrane only and the right side (RS) with collagen membrane and hDPSC. In two rats, the RS had collagen membrane only and nothing was added at the left side (controls). Cells were used after in vitro characterization as mesenchymal cells. Animals were euthanized at 7, 20, 30, 60, and 120 days postoperatively and cranial tissue samples were taken from the defects for histologic analysis. Analysis of the presence of human cells in the new bone was confirmed by molecular analysis. The hDPSC lineage was positive for the four mesenchymal cell markers tested and showed osteogenic, adipogenic, and myogenic in vitro differentiation. We observed bone formation 1 month after surgery in both sides, but a more mature bone was present in the RS. Human DNA was polymerase chain reaction-amplified only at the RS, indicating that this new bone had human cells. The us e of hDPSC in NIS rats did not cause any graft. rejection. Our findings suggest that hDPSC is an additional cell resource for correcting large cranial defects in rats and constitutes a promising model for reconstruction of human large cranial defects in craniofacial surgery.

ERCC1 protein, mRNA expression and T19007C polymorphism as prognostic markers in head and neck squamous cell carcinoma patients treated with surgery and adjuvant cisplatin-based chemoradiation

Adjuvant cisplatin-based chemoradiation improves survival in HNSCC patients presenting with risk features. ERCC1 (excision repair cross-complementation group 1) is associated with resistance to chemo- and radiation therapy and may have a prognostic value in HNSCC patients. Here we studied ERCC1 expression and the polymorphism T19007C as prognostic markers in these patients. This is a retrospective and translational analysis, where ERCC1 protein expression was evaluated by immunohistochemistry, using an H-score, and mRNA expression was determined by RT-PCR. T 19007C genotypes were detected by PCR-RFLP carried out using DNA template extracted from normal lymph nodes. A high H-score was seen in 32 patients (54%), who presented better 5-year overall survival (5-y OS: 50% vs. 18%, HR 0.43, p=0.026). Fifteen out of 45 patients (33%), with high mRNA expression, presented better 5-year overall survival (OS) (86% vs. 30%, HR 0.26, p=0.052). No OS difference was detected among T 19007C genotypes. High H-score and mRNA expression remained significant as favorable prognostic factors in a multivariate analysis. Collectively, our results suggest that high ERCC1 expression seems to be associated with better OS rates in HNSCC patients submitted to adjuvant cisplatin-based chemoradiation.

Effects of (-)-RO363 at human atrial beta-adrenoceptor subtypes, the human cloned beta(3)-adrenoceptor and rodent intestinal beta(3)-adrenoceptors

1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.

Evaluation of Maxillary Alveolar Reconstruction Using a Resorbable Collagen Sponge with Recombinant Human Bone Morphogenetic Protein-2 in Cleft Lip and Palate Patients

Introduction: A resorbable collagen matrix with recombinant human bone morphogenetic protein (rhBMP-2) was compared with traditional iliac crest bone graft for the closure of alveolar defects during secondary dental eruption. Methods: Sixteen patients with unilateral cleft lip and palate, aged 8 to 12 years, were selected and randomly assigned to group 1 (rhBMP-2) or group 2 (iliac crest bone graft). Computed tomography was performed to assess both groups preoperatively and at months 6 and 12 postoperatively. Bone height and defect volume were calculated through Osirix Dicom Viewer (Pixmeo, Apple Inc.). Overall morbidity was recorded. Results: Preoperative and follow-up examinations revealed progressive alveolar bone union in all patients. For group 1, final completion of the defect with a 65.0% mean bone height was detected 12 months postoperatively. For group 2, final completion of the defect with an 83.8% mean bone height was detected 6 months postoperatively. Dental eruption routinely occurred in both groups. Clinical complications included significant swelling in three group 1 patients (37.5%) and significant donor-site pain in seven group 2 patients (87.5%). Conclusions: For this select group of patients with immature skeleton, rhBMP-2 therapy resulted in satisfactory bone healing and reduced morbidity compared with traditional iliac crest bone grafting.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Pentoxifylline modifies three-dimensional collagen lattice model contraction and expression of collagen types I and III by human fibroblasts derived from post-burn hypertrophic scars and from normal skin

Fibroblasts are thought to be partially responsible for the persisting contractile forces that result in burn contractures. Using a monolayer cell culture and fibroblast populated collagen lattice (FPCL) three-dimensional model we subjected hypertrophic scar and non-cicatricial fibroblasts to the antifibrogenic agent pentoxifylline (PTF - 1 mg/mL) in order to reduce proliferation, collagen types I and III synthesis and model contraction. Fibroblasts were isolated from post-burn hypertrophic scars (HSHF) and non-scarred skin (NHF). Cells were grown in monolayers or incorporated into FPCL`s and exposed to PTF. In monolayer, cell number proliferation was reduced (46.35% in HSHF group and 37.73% in NHF group, p < 0.0001). PTF selectively inhibited collagen III synthesis in the HSHF group while inhibition was more evident to type I collagen synthesis in the NHF group. PTF also reduced contraction in both (HSHF and NHF) FPCL. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.

Biologically active conformer of the effector region of human C5a and modulatory effects of N-terminal receptor binding determinants on activity

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Serum from children with polyarticular juvenile idiopathic arthritis (pJIA) inhibits differentiation, mineralization and may increase apoptosis of human osteoblasts ""in vitro""

We examined the effects of polyarticular juvenile idiopathic arthritis (pJIA) serum on proliferation, differentiation, mineralization, and apoptosis of human osteoblast cells (hOb) in culture. The hOb were cultured with 10% serum from active pJIA and healthy controls (CT) and were tested for DNA synthesis, alkaline phosphatase (AP) activity, osteocalcin (OC) secretion, calcium levels, caspase 3 activity, and DNA fragmentation. None of the patients had used glucocorticoids for at least 1 month before the study, or any other drug that can affect bone mineral metabolism. Human inflammatory cytokine levels (IL-6, IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70) were measured in pJIA and CT sera. Low levels of AP activity was observed in pJIA cultures compared with CT cultures (67.16 +/- 53.35 vs 100.11 +/- 50.64 mu mol p-nitrophenol/h(-1) mg(-1) protein, P=0.008). There was also a significant decrease in OC secretion (9.23 +/- 5.63 vs 12.82 +/- 7.02 ng/mg protein, P=0.012) and calcium levels (0.475 +/- 0.197 vs 0.717 +/- 0.366 mmol/l, P=0.05) in pJIA hOb cultures. No difference was observed in cell proliferation (323.56 +/- 108.23 vs 328.91 +/- 88.03 dpm/mg protein, P=0.788). Osteoblasts cultured with JIA sera showed lower levels of DNA and increased fragmentation than osteoblasts cultured with CT sera. pJIA sera showed higher IL-6 values than CT (21.44 +/- 9.31 vs 3.58 +/- 2.38 pg/ml, P<0.001), but no difference was observed related to IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70 between pJIA and controls. This study suggests that serum from children with pJIA inhibits differentiation, mineralization and may increase apoptosis of hOb cultures, and inflammatory cytokines such as IL-6 might be a mechanism in this find. These results may represent an alternative therapeutic target for prevention and treatment of bone loss in JIA.

HUMAN CHOLESTERYL ESTER TRANSFER PROTEIN EXPRESSION ENHANCES THE MOUSE SURVIVAL RATE IN AN EXPERIMENTAL SYSTEMIC INFLAMMATION MODEL: A NOVEL ROLE FOR CETP

Mice expressing human cholesteryl ester transfer protein (huCETP) are more resistant to Escherichia coli bacterial wall LIPS because death rates 5 days after intraperitoneal inoculation of LIPS were higher in wild-type than in huCETP(+/-) mice, whereas all huCETP(+/+) mice remained alive. After LIPS inoculation, plasma concentrations of TNF-alpha and IL-6 increased less in huCETP(+/+) than in wild-type mice. LPS in vitro elicited lower TNF-alpha production by CETP expressing than by wild-type macrophages. In addition, TNF-alpha production by RAW 264.7 murine macrophages increased on incubation with LPS but decreased in a dose-dependent manner when human CETP was added to the medium. Human CETP in vitro enhanced the LIPS binding to plasma high-density lipoprotein/low-density lipoprotein. The liver uptake of intravenous infused C-14-LPS from Salmonella typhimurium was greater in huCETP(+/+) than in wild-type mice. Present data indicate for the first time that CETP is an endogenous component involved in the first line of defense against an exacerbated production of proinflammatory mediators.

CD4+T cells from HIV-1-infected patients recognize wild-type and mutant human immunodeficiency virus-1 protease epitopes

P>Human immunodeficiency virus (HIV)-1 protease is a known target of CD8+ T cell responses, but it is the only HIV-1 protein in which no fully characterized HIV-1 protease CD4 epitopes have been identified to date. We investigated the recognition of HIV-1 protease by CD4+ T cells from 75 HIV-1-infected, protease inhibitor (PI)-treated patients, using the 5,6-carboxyfluorescein diacetate succinimidyl ester-based proliferation assay. In order to identify putative promiscuous CD4+ T cell epitopes, we used the TEPITOPE algorithm to scan the sequence of the HXB2 HIV-1 protease. Protease regions 4-23, 45-64 and 73-95 were identified; 32 sequence variants of the mentioned regions, encoding frequent PI-induced mutations and polymorphisms, were also tested. On average, each peptide bound to five of 15 tested common human leucocyte antigen D-related (HLA-DR) molecules. More than 80% of the patients displayed CD4+ as well as CD8+ T cell recognition of at least one of the protease peptides. All 35 peptides were recognized. The response was not associated with particular HLA-DR or -DQ alleles. Our results thus indicate that protease is a frequent target of CD4+ along with CD8+ proliferative T cell responses by the majority of HIV-1-infected patients under PI therapy. The frequent finding of matching CD4+ and CD8+ T cell responses to the same peptides may indicate that CD4+ T cells provide cognate T cell help for the maintenance of long-living protease-specific functional CD8+ T cells.

Human immunodeficiency virus test-seeking blood donors in a large blood bank in Sao Paulo, Brazil

BACKGROUND: Persons with human immunodeficiency virus (HIV) risk behaviors are excluded from donation to reduce the risk of transfusion-transmitted infection. Persons donating to be tested for HIV may therefore deny risk behaviors. STUDY DESIGN AND METHODS: A random sample of donors completed a survey on motivations, knowledge, and attitudes on the screening process. Donors were considered test seekers if they agreed with two statements ""I think that blood donation is a good, fast, and anonymous way to get my blood tested"" and ""I donate to get my test results."" This study was conducted from June to November 2006 at the largest blood bank in Sao Paulo, Brazil. RESULTS: Of 3061 participants, 208 (7%) were test seekers. They tended to be male and had a lower educational level. They were more likely to have incorrect knowledge about blood safety (e.g., not knowing that a unit can test antibody negative and still transmit infection, 60% vs. 42%, p = 0.02), express dissatisfaction with screening questions (e.g., feeling that important questions were not asked, 14% vs. 5%, p < 0.01), and concur that donors do not answer questions truthfully (e.g., donors have more sexual partners than they admit, 29% vs. 18%, p < 0.01). Test seekers were more likely to believe that it is acceptable to donate blood to get tested for HIV (41% vs. 10%, p < 0.01). CONCLUSIONS: Test-seeking motivation, coupled with low knowledge of window period risk, is counter to improving blood safety and to donor prevention needs. Donor education needs to be improved along with availability of appropriate HIV counseling and testing.

Isolated limb perfusion with melphalan for human melanoma xenografts in the hindlimb of nude rats: A surviving animal model

We have established a surviving model of isolated limb perfusion using xenografts of the human melanoma cell line MM 96L injected subcutaneously into the hindlimb of a nude rat, The femoral artery and vein were cannulated via the left renal artery and vein and the hind limb was isolated using tourniquets. The limb was perfused with Krebs Heinseleit buffer at 37 degrees C containing 4.7% bovine serum albumin at a constant flow rate of 4 mi per min for 30-60 min with 100% survival of the animals, Tumour vascularization and blood flow were demonstrated using vascular casts and [Cr-51]-microspheres. Following the addition of melphalan (15 or 100 mu g/ml), drug concentrations in the perfusate, tissues and systemic circulation were determined using high pressure liquid chromatography (HPLC), Systemic leakage, assessed using [I-125]albumin and melphalan and detected by a gamma-counter and HPLC respectively, was <0.5%. The melphalan concentration and tissue flow rate in the tumour deposits were 40 and 30% respectively, when compared with the surrounding subcutaneous tissue, At a dose of 15 mu g/ml, melphalan caused a reduction in tumour growth after 60 min perfusion, and a significant reduction in tumour size was seen when the melphalan dose was 100 mu g/ml. The surviving nude rat model of isolated limb perfusion for recurrent melanoma will allow examination of optimal perfusion conditions, along with the pharmacokinetics, pharmacodynamics and efficacy of melphalan and other drugs.

The-2518 bp promoter polymorphism at CCL2/MCP1 influences susceptibility to mucosal but not localized cutaneous leishmaniasis in Brazil

Mucosal leishmaniasis (ML) follows localized cutaneous leishmaniasis (CL) caused by Leishmania braziliensis. Proinflammatory responses mediate CL self-healing but are exaggerated in ML Proinflammatory monocyte chemoattractant protein 1 (MCP-1; encoded by CCL2) is associated with CL We explore its role in CL/ML through analysis of the regulatory CCL2 -2518 bp promoter polymorphism in CL/ML population samples and families from Brazil. Genotype frequencies were compared among ML/CL cases and control groups using logistic regression and the family-based association test (FBAT). MCP-1 was measured in plasma and macrophages. The GG recessive genotype at CCL2 -2518 bp was more common in patients with ML (N = 67) than in neighborhood control (NC; N = 60) subjects (OR 1.78; 95% Cl 1.01-3.14; P = 0.045), than in NC combined with leishmanin skin-test positive (N = 60) controls (OR 4.40; 95% CI 1.42-13.65; P = 0.010), and than in controls combined with CL (N = 60) patients (OR 2.78; 95% CI 1.13-6.85; P = 0.045). No associations were observed for CL compared to any groups. FBAT (91 ML and 223 CL cases in families) confirmed recessive association of ML with allele G (Z = 2.679; P = 0.007). Higher levels of MCP-1 occurred in plasma (P = 0.03) and macrophages (P < 0.0001) from GG compared to AA individuals. These results suggest that high MCP-1 increases risk of ML (C) 2010 Elsevier B.V. All rights reserved.