977 resultados para Human Bone-marrow


Relevância:

100.00% 100.00%

Publicador:

Resumo:

DNA repair alkyltransferases protect organisms against the cytotoxic, mutagenic, and carcinogenic effects of alkylating agents by transferring alkyl adducts from DNA to an active cysteine on the protein, thereby restoring the native DNA structure. We used random sequence substitutions to gain structure-function information about the human O6-methylguanine-DNA methyltransferase (EC 2.1.1.63), as well as to create active mutants. Twelve codons surrounding but not including the active cysteine were replaced by a random nucleotide sequence, and the resulting random library was selected for the ability to provide alkyltransferase-deficient Escherichia coli with resistance to the methylating agent N-methyl-N'-nitro-N-nitrosoguanidine. Few amino acid changes were tolerated in this evolutionarily conserved region of the protein. One mutation, a valine to phenylalanine change at codon 139 (V139F), was found in 70% of the selected mutants; in fact, this mutant was selected much more frequently than the wild type. V139F provided alkyltransferase-deficient bacteria with greater protection than the wild-type protein against both the cytotoxic and mutagenic effects of N-methyl-N'-nitro-N-nitrosoguanidine, increasing the D37 over 4-fold and reducing the mutagenesis rate 2.7-5.5-fold. This mutant human alkyltransferase, or others similarly created and selected, could be used to protect bone marrow cells from the cytotoxic side effects of alkylation-based chemotherapeutic regimens.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Neuroblastoma (NB) is characterized by the second highest spontaneous regression of any human malignant disorder, a phenomenon that remains to be elucidated. In this study, a survey of 94 normal human adult sera revealed a considerable natural humoral cytotoxicity against human NB cell lines in approximately one-third of the tested sera of both genders. Specific cell killing by these sera was in the range of 40% to 95%. Serum cytotoxicity was dependent on an intact classical pathway of complement. By several lines of evidence, IgM antibodies were identified as the cytotoxic factor in the sera. Further analyses revealed that a 260-kDa protein was recognized by natural IgM of cytotoxic sera in Western blots of NB cell extracts. The antigen was expressed on the surface of seven human NB cell lines but not on human melanoma or other control tumor cell lines derived from kidney, pancreas, colon, bone, skeletal muscle, lymphatic system, and bone marrow. Furthermore, no reactivity was observed with normal human fibroblasts, melanocytes, and epidermal keratinocytes. The antigen was expressed in vivo as detected by immunohistochemistry in both the tumor of a NB patient and NB tumors established in nude rats from human NB cell lines. Most interestingly, the IgM anti-NB antibody was absent from the sera of 11 human NB patients with active disease. The anti-NB IgM also could not be detected in tumor tissue obtained from a NB patient. Collectively, our data suggest the existence of a natural humoral immunological tumor defense mechanism, which could account for the in vivo phenomenon of spontaneous NB tumor regression.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

PR-39 is a porcine 39-aa peptide antibiotic composed of 49% proline and 24% arginine, with an activity against Gram-negative bacteria comparable to that of tetracycline. In Escherichia coli, it inhibits DNA and protein synthesis. PR-39 was originally isolated from pig small intestine, but subsequent cDNA cloning showed that the gene is expressed in the bone marrow. The open reading frame of the clone showed that PR-39 is made as 173-aa precursor whose proregion belongs to the cathelin family. The PR39 gene, which is rather compact and spans only 1784 bp has now been sequenced. The coding information is split into four exons. The first exon contains the signal sequence of 29 residues and the first 37 residues of the cathelin propart. Exons 2 and 3 contain only cathelin information, while exon 4 codes for the four C-terminal cathelin residues and the mature PR-39 peptide extended by three residues. The sequenced upstream region (1183 bp) contains four potential recognition sites for NF-IL6 and three for APRF, transcription factors known to regulate genes for both cytokines and acute phase response factors. Genomic hybridizations revealed a fairly high level of restriction fragment length polymorphism and indicated that there are at least two copies of the PR39 gene in the pig genome. PR39 was mapped to pig chromosome 13 by linkage and in situ hybridization mapping. The gene for the human peptide antibiotic FALL-39 (also a member of the cathelin family) was mapped to human chromosome 3, which is homologous to pig chromosome 13.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Successful gene transfer into stem cells would provide a potentially useful therapeutic modality for treatment of inherited and acquired disorders affecting hematopoietic tissues. Coculture of primate bone marrow cells with retroviral producer cells, autologous stroma, or an engineered stromal cell line expressing human stem cell factor has resulted in a low efficiency of gene transfer as reflected by the presence of 0.1-5% of genetically modified cells in the blood of reconstituted animals. Our experiments in a nonhuman primate model were designed to explore various transduction protocols that did not involve coculture in an effort to define clinically useful conditions and to enhance transduction efficiency of repopulating cells. We report the presence of genetically modified cells at levels ranging from 0.1% (granulocytes) to 14% (B lymphocytes) more than 1 year following reconstitution of myeloablated animals with CD34+ immunoselected cells transduced in suspension culture with cytokines for 4 days with a retrovirus containing the glucocerebrosidase gene. A period of prestimulation for 7 days in the presence of autologous stroma separated from the CD34+ cells by a porous membrane did not appear to enhance transduction efficiency. Infusion of transduced CD34+ cells into animals without myeloablation resulted in only transient appearance of genetically modified cells in peripheral blood. Our results document that retroviral transduction of primate repopulating cells can be achieved without coculture with stroma or producer cells and that the proportion of genetically modified cells may be highest in the B-lymphoid lineage under the given transduction conditions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We have attempted to model human metastatic disease by implanting human target organs into the immunodeficient C.B-17 scid/scid (severe combined immunodeficiency; SCID) mouse, creating SCID-hu mice. Preferential metastasis to implants of human fetal lung and human fetal bone marrow occurred after i.v. injection of human small cell lung cancer (SCLC) cells into SCID-hu mice; the homologous mouse organs were spared. Clinically more aggressive variant SCLC cells metastasized more efficiently to human fetal lung implants than did cells from classic SCLC. Metastasis of variant SCLC to human fetal bone marrow was enhanced in SCID-hu mice exposed to gamma-irradiation or to interleukin 1 alpha. These data indicate that the SCID-hu mice may provide a model in which to study species- and tissue-specific steps of the human metastatic process.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The transcription factor NF-E2 (nuclear factor erythroid 2), interacting via DNA motifs within regulatory regions of several hematopoietic genes, is thought to mediate the enhancer activity of the globin locus control regions. By screening a human fetal liver cDNA library with probes derived from mouse NF-E2, we have isolated a splicing variant of the NF-E2 gene (fNF-E2) that differs in the 5' untranslated region from the previously reported cDNA (aNF-E2). The fNF-E2 isoform is transcribed from an alternative promoter located in the 3' end of the first intron and joined by alternative splicing to the second and third exons, which are shared by both RNA isoforms. Although the two forms produce the same protein, they are expressed in different ratios during development. fNF-E2 is more abundant in the fetal liver and less abundant in the adult bone marrow compared to the previously described form. Their distribution apparently follows the differential expression of fetal and adult hemoglobins.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

After initial infection, human cytomegalovirus remains in a persistent state with the host. Immunity against the virus controls replication, although intermitent viral shedding can still take place in the seropositive immunocompetent person. Replication of cytomegalovirus in the absence of an effective immune response is central to the pathogenesis of disease. Therefore, complications are primarily seen in individuals whose immune system is immature, or is suppressed by drug treatment or coinfection with other pathogens. Although our increasing knowledge of the host-virus relationship has lead to the development of new pharmacological strategies for cytomegalovirus-associated infections, these strategies all have limitations-eg, drug toxicities, development of resistance, poor oral bioavailability, and low potency. Immune-based therapies to complement pharmacological strategies for the successful treatment of virus-associated complications should be prospectively investigated.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Despite more than a 10-fold increase in T cell numbers in G-CSF-mobilized peripheral blood stem cell (PBSC) grafts, incidence and severity of acute graft-vs-host disease (GVHD) are comparable to bone marrow transplantation. As CD1d-restricted, Valpha24(+)Vbeta11(+) NKT cells have pivotal immune regulatory functions and may influence GVHD, we aimed to determine whether G-CSF has any effects on human NKT cells. In this study, we examined the frequency and absolute numbers of peripheral blood NKT cells in healthy stem cell donors (n = 8) before and following G-CSF (filgrastim) treatment. Effects of in vivo and in vitro G-CSF on NKT cell cytokine expression profiles and on responsiveness of NKT cell subpopulations to specific stimulation by alpha-galactosylceramide (alpha-GalCer) were assessed. Contrary to the effects on conventional T cells, the absolute number of peripheral blood NKT cells was unaffected by G-CSF administration. Furthermore, responsiveness of NKT cells to alpha-GalCer stimulation was significantly decreased (p < 0.05) following exposure to G-CSF in vivo. This hyporesponsiveness was predominantly due to a direct effect on NKT cells, with a lesser contribution from G-CSF-mediated changes in APC. G-CSF administration resulted in polarization of NKT cells toward a Th2, IL-4-secreting phenotype following alpha-GalCer stimulation and preferential expansion of the CD4(+) NKT cell subset. We conclude that G-CSF has previously unrecognized differential effects in vivo on NKT cells and conventional MHC-restricted T cells, and effects on NKT cells may contribute to the lower than expected incidence of GVHD following allogeneic peripheral blood stem cell transplantation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cell-based therapies have the potential to contribute to global healthcare, whereby the use of living cells and tissues can be used as medicinal therapies. Despite this potential, many challenges remain before the full value of this emerging field can be realized. The characterization of input material for cell-based therapy bioprocesses from multiple donors is necessary to identify and understand the potential implications of input variation on process development. In this work, we have characterized bone marrow derived human mesenchymal stem cells (BM-hMSCs) from multiple donors and discussed the implications of the measurable input variation on the development of autologous and allogeneic cell-based therapy manufacturing processes. The range of cumulative population doublings across the five BM-hMSC lines over 30 days of culture was 5.93, with an 18.2% range in colony forming efficiency at the end of the culture process and a 55.1% difference in the production of interleukin-6 between these cell lines. It has been demonstrated that this variation results in a range in the process time between these donor hMSC lines for a hypothetical product of over 13 days, creating potential batch timing issues when manufacturing products from multiple patients. All BM-hMSC donor lines demonstrated conformity to the ISCT criteria but showed a difference in cell morphology. Metabolite analysis showed that hMSCs from the different donors have a range in glucose consumption of 26.98 pmol cell−1 day−1, Lactate production of 29.45 pmol cell−1 day−1 and ammonium production of 1.35 pmol cell−1 day−1, demonstrating the extent of donor variability throughout the expansion process. Measuring informative product attributes during process development will facilitate progress towards consistent manufacturing processes, a critical step in the translation cell-based therapies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background aims: The cost-effective production of human mesenchymal stromal cells (hMSCs) for off-the-shelf and patient specific therapies will require an increasing focus on improving product yield and driving manufacturing consistency. Methods: Bone marrow-derived hMSCs (BM-hMSCs) from two donors were expanded for 36 days in monolayer with medium supplemented with either fetal bovine serum (FBS) or PRIME-XV serum-free medium (SFM). Cells were assessed throughout culture for proliferation, mean cell diameter, colony-forming potential, osteogenic potential, gene expression and metabolites. Results: Expansion of BM-hMSCs in PRIME-XV SFM resulted in a significantly higher growth rate (P < 0.001) and increased consistency between donors compared with FBS-based culture. FBS-based culture showed an inter-batch production range of 0.9 and 5 days per dose compared with 0.5 and 0.6 days in SFM for each BM-hMSC donor line. The consistency between donors was also improved by the use of PRIME-XV SFM, with a production range of 0.9 days compared with 19.4 days in FBS-based culture. Mean cell diameter has also been demonstrated as a process metric for BM-hMSC growth rate and senescence through a correlation (R2 = 0.8705) across all conditions. PRIME-XV SFM has also shown increased consistency in BM-hMSC characteristics such as per cell metabolite utilization, in vitro colony-forming potential and osteogenic potential despite the higher number of population doublings. Conclusions: We have increased the yield and consistency of BM-hMSC expansion between donors, demonstrating a level of control over the product, which has the potential to increase the cost-effectiveness and reduce the risk in these manufacturing processes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Damage to articular cartilage of the knee can be debilitating because it lacks the capacity to repair itself and can progress to degenerative disorders such as osteoarthritis. The current gold standard for treating cartilage defects is autologous chondrocyte implantation (ACI). However, one of the major limitations of ACI is the use of chondrocytes, which dedifferentiate when grown in vitro and lose their phenotype. It is not clear whether the dedifferentiated chondrocytes can fully redifferentiate upon in vivo transplantation. Studies have suggested that undifferentiated mesenchymal stem or stromal cells (MSCs) from bone marrow (BM) and adipose tissue (AT) can undergo chondrogenic differentiation. Therefore, the main aim of this thesis was to examine BM and AT as a cell source for chondrogenesis using clinical scaffolds. Initially, freshly isolated cells were compared with culture expanded MSCs from BM and AT in Chondro-Gide®, Alpha Chondro Shield® and Hyalofast™. MSCs were shown to grow better in the three scaffolds compared to freshly isolated cells. BM MSCs in Chondro-Gide® were shown to have increased deposition of cartilage specific extracellular matrix (ECM) compared to AT MSCs. Further, this thesis has sought to examine whether CD271 selected MSCs from AT were more chondrogenic than MSCs selected on the basis of plastic adherence (PA). It was shown that CD271+MSCs may have superior chondrogenic properties in vitro and in vivo in terms of ECM deposition. The repair tissue seen after CD271+MSC transplantation combined with Alpha Chondro Shield® was also less vascularised than that seen after transplantation with PA MSCs in the same scaffold, suggesting antiangiogenic activity. Since articular cartilage is an avascular tissue, CD271+MSCs may be a better suited cell type compared to the PA MSCs. Hence, this study has increased the current understanding of how different cell-scaffold combinations may best be used to promote articular cartilage repair.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

For in vitro differentiation of bone marrow-derived mesenchymal stem cells/mesenchymal stromal cells into osteoblasts by 2-dimensional cell culture a variety of protocols have been used and evaluated in the past. Especially the external phosphate source used to induce mineralization varies considerably both in respect to chemical composition and concentration. In light of the recent findings that inorganic phosphate directs gene expression of genes crucial for bone development, the need for a standardized phosphate source in in vitro differentiation becomes apparent. We show that chemical composition (inorganic versus organic phosphate origin) and concentration of phosphate supplementation exert a severe impact on the results of gene expression for the genes commonly used as markers for osteoblast formation as well as on the composition of the mineral formed. Specifically, the intensity of gene expression does not necessarily correlate with a high quality mineralized matrix. Our study demonstrates advantages of using inorganic phosphate instead of beta-glycerophosphate and propose colorimetric quantification methods for calcium and phosphate ions as cost-and time-effective alternatives to X-ray diffraction and Fourier-transform infrared spectroscopy for determination of the calcium phosphate ratio and concentration of mineral matrix formed under in vitro-conditions. We critically discuss the different assays used to assess in vitro bone formation in respect to specificity and provide a detailed in vitro protocol that could help to avoid contradictory results due to variances in experimental design.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Following cultivation of distinct mesenchymal stem cell (MSC) populations derived from human umbilical cord under hypoxic conditions (between 1.5% to 5% oxygen (O-2)) revealed a 2- to 3-fold reduced oxygen consumption rate as compared to the same cultures at normoxic oxygen levels (21% O-2). A simultaneous measurement of dissolved oxygen within the culture media from 4 different MSC donors ranged from 15 mu mol/L at 1.5% O-2 to 196 mu mol/L at normoxic 21% O-2. The proliferative capacity of the different hypoxic MSC populations was elevated as compared to the normoxic culture. This effect was paralleled by a significantly reduced cell damage or cell death under hypoxic conditions as evaluated by the cellular release of LDH whereby the measurement of caspase 3/7 activity revealed little if any differences in apoptotic cell death between the various cultures. The MSC culture under hypoxic conditions was associated with the induction of hypoxia-inducing factor-alpha (HIF-1 alpha) and an elevated expression of energy metabolism-associated genes including GLUT-1, LDH and PDK1. Concomitantly, a significantly enhanced glucose consumption and a corresponding lactate production could be observed in the hypoxic MSC cultures suggesting an altered metabolism of these human stem cells within the hypoxic environment.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

PURPOSE: Evaluate the bone tissue recovery following transplantation of ovine mesenchymal stem cells (MSC) from bone marrow and human immature dental-pulp stem cells (hIDPSC) in ovine model of induced osteonecrosis of femoral head (ONFH). METHODS: Eight sheep were divided in three experimental groups. First group was composed by four animals with ONFH induced by ethanol through central decompression (CD), for control group without any treatment. The second and third group were compose by two animals, six weeks after ONFH induction received transplantation of heterologous ovine MSC (CD + oMSC), and hIDPSC (CD + hIDPSC), respectively. In both experiments the cells were transplanted without application of any type of immunosupression protocol. RESULTS: Our data indicate that both cell types used in experiments were able to proliferate within injured site providing bone tissue recovery. The histological results obtained from CD+hIDPSC suggested that the bone regeneration in such animals was better than that observed in CD animals. CONCLUSION: Mesenchymal stem cell transplant in induced ovine osteonecrosis of femoral head by central decompression technique is safe, and apparently favors bone regeneration of damaged tissues.