937 resultados para Function and mobility
Resumo:
Cardiovascular mortality is 15 to 30 times higher in patients with chronic kidney disease than in the age-adjusted general population. Even minor renal dysfunction predicts cardiovascular events and death in the general population. In patients with atherosclerotic renovascular disease the annual cardiovascular event and death rate is even higher. The abnormalities in coronary and peripheral artery function in the different stages of chronic kidney disease and in renovascular disease are still poorly understood, nor have the cardiac effects of renal artery revascularization been well characterized, although considered to be beneficial. This study was conducted to characterize myocardial perfusion and peripheral endothelial function in patients with chronic kidney disease and in patients with atherosclerotic renovascular disease. Myocardial perfusion was measured with positron emission tomography (PET) and peripheral endothelial function with brachial artery flow-mediated dilatation. It has been suggested that the poor renal outcomes after the renal artery revascularization could be due to damage in the stenotic kidney parenchyma; especially the reduction in the microvascular density, changes mainly evident at the cortical level which controls almost 80% of the total renal blood flow. This study was also performed to measure the effect of renal artery stenosis revascularization on renal perfusion in patients with renovascular disease. In order to do that a PET-based method for quantification of renal perfusion was developed. The coronary flow reserve of patients with chronic kidney disease was similar to the coronary flow reserve of healthy controls. In renovascular disease the coronary flow reserve was, however, markedly reduced. Flow-mediated dilatation of brachial artery was decreased in patients with chronic kidney disease compared to healthy controls, and even more so in patients with renovascular disease. After renal artery stenosis revascularization, coronary vascular function and renal perfusion did not improve in patients with atherosclerotic renovascular disease, but in patients with bilateral renal artery stenosis, flow-mediated dilatation improved. Chronic kidney disease does not significantly affect coronary vascular function. On the contrary, coronary vascular function was severely deteriorated in patients with atherosclerotic renovascular disease, possibly because of diffuse coronary artery disease and/or diffuse microvascular disease. The peripheral endothelial function was disturbed in patients with chronic kidney disease and even more so in patient with atherosclerotic renovascular disease. Renal artery stenosis dilatation does not seem to offer any benefits over medical treatment in patients with renovascular disease, since revascularization does not improve coronary vascular function or renal perfusion.
Resumo:
Matrix metalloproteinase-13 (MMP-13) is a potent proteolytic enzyme, whose expression has been previously associated with fetal bone development and postnatal bone remodeling and with adult gingival wound healing. MMP-13 is also known to be involved in the growth and invasion of various cancers including squamous cell carcinoma (SCC) of the skin. The aim of this study was to further elucidate the function and regulation of MMP-13 in wound repair and cancer. In this study, it was shown that fetal skin fibroblasts express MMP-13 in response to transforming growth factor-β in a p38 MAP kinase dependent manner. In addition, MMP-13 was found to be expressed in vivo by wound fibroblasts in human fetal skin grafted on SCID mice. Adenovirally delivered expression of MMP-13 enhanced collagen matrix contraction by fibroblasts in vitro in association with altered cytoskeletal structure, enhanced proliferation and survival. These results indicate that MMP-13 is involved in cell-mediated collagen matrix remodeling and suggest a role for MMP-13 in superior matrix remodeling and scarless healing of fetal skin wounds. Using an MMP-13 deficient mouse strain, it was shown that MMP-13 is essential for the normal development of experimental granulation tissue in mice. MMP-13 was implicated in the regulation of myofibroblast function and angiogenesis and the expression of genes involved in cellular proliferation and movement, immune response, angiogenesis and proteolysis. Finally, epidermal mitogen, keratinocyte growth factor (KGF) was shown to suppress the malignant properties of skin SCC cells by downregulating the expression of several target genes with potential cancer promoting properties, including MMP-13, and by reducing SCC cell invasion. These results provide evidence that MMP-13 potently regulates cell viability, myofibroblast function and angiogenesis associated with wound healing and cancer. In addition, fibroblasts expressing MMP-13 show high collagen reorganization capacity. Moreover, the results suggest that KGF mediates the anti-cancer effects on skin SCC
Resumo:
Objective: To evaluate the influence of end-stage liver disease and orthotopic liver transplantation in the pituitary function and hormone metabolism before and after liver transplantation.Methods: In a prospective study, serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2) and prolactin (PRL) of 30 male patients with cirrhosis were determined two to four hours before and six months after liver transplantation. The results were compared according to the Model for End-stage Liver Disease (MELD).Results: male patients with liver cirrhosis have hypogonadism. FSH was normal, but inappropriately low due to androgen failure; E2 and PRL, on their turn, were high. After liver transplantation, FSH and LH levels increased (p < 0.05), whereas E2 and PRL normalized (p < 0.05). The MELD score did not influence changes in FSH, PRL and LH, however, the more severe the cirrhosis was, the more significant was the normalization of E2 (p = 0.01).Conclusion: Patients with cirrhosis and male hypogonadism have inappropriately normal levels of FSH and LH, associated with an increase in E2 and LRP. After liver transplantation, FSH and LH increased, while E2 and PRL returned to normal. Changes in E2 levels were most pronounced in patients with MELD > 18. The severity of cirrhosis had no influence on FSH, PRL and LH.
Resumo:
Cystic fibrosis (CF) is a lethal autosomal recessive genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR). Mutations in the CFTR gene may result in a defective processing of its protein and alter the function and regulation of this channel. Mutations are associated with different symptoms, including pancreatic insufficiency, bile duct obstruction, infertility in males, high sweat Cl-, intestinal obstruction, nasal polyp formation, chronic sinusitis, mucus dehydration, and chronic Pseudomonas aeruginosa and Staphylococcus aureus lung infection, responsible for 90% of the mortality of CF patients. The gene responsible for the cellular defect in CF was cloned in 1989 and its protein product CFTR is activated by an increase of intracellular cAMP. The CFTR contains two membrane domains, each with six transmembrane domain segments, two nucleotide-binding domains (NBDs), and a cytoplasmic domain. In this review we discuss the studies that have correlated the role of each CFTR domain in the protein function as a chloride channel and as a regulator of the outwardly rectifying Cl- channels (ORCCs).
Resumo:
The effects of strenuous exercise before and during pregnancy on the renal function and morphological alterations of the progeny were determined in a study on female Wistar rats. This research was done based on a previous study carried out in our laboratory, which showed morphological alterations in rats submitted to this kind of exercise. As the form is related to the function, the physiological relevance of submitting a pregnant female to a high-intensity exercise training regimen could be explained by the fact that morphological alterations can influence kidney function. The animals were assigned to one of two groups: control animals that did not exercise during pregnancy and trained animals that swam for 120 min 5 days a week for 8 weeks before pregnancy and daily for 60 min over a period of 8 weeks starting on the second day of pregnancy. Seven rats of each group were analyzed for morphological alterations and for renal function. The progeny of the rats used for morphological evaluation were born by cesarean section and the progeny of the animals used to evaluate renal function were born normally. The progeny were two months old when renal function was evaluated. Fertility and morbidity were the same for both groups. Strenuous maternal exercise had no significant influence on glomerular filtration rate (GFR) but renal plasma flow was lower in the progeny of the trained group (mean ± SD, 16.65 ± 3.77 ml min-1 kg-1) compared to the progeny of the control group (33.42 ± 2.56 ml min-1 kg-1). Antidiuretic and antinatriuretic effects on the progeny of the trained group were observed, since urine flow as percentage of GFR and the fraction of urinary sodium excretion were lower in this group (1.38 ± 0.10 and 0.60 ± 0.04%, respectively) compared to the progeny of the control group (2.36 ± 0.11 and 1.55 ± 0.20%, respectively). Moreover, in this exercise program, fetuses from trained animals were small-sized (2.45 ± 0.19 vs 4.66 ± 2.45 g for control animals) and showed lower differentiation compared to fetuses from the control group. These effects were probably caused by caloric restriction, hypoxia and reduction of umbilical cord length.
Resumo:
The objective of the present study was to determine contrast sensitivity curves of concentric circular patterns with radial frequencies of 0.25, 0.5, 1.0, 2.0, and 4.0 cycles per degree in young and older adult volunteers. These parameters were also compared with sensitivity contrasts for sine-wave gratings. All participants had normal acuity vision and were free of identifiable ocular illness. Contrast sensitivity was measured in 6 young adults aged 19 to 23 years and 6 older adults aged 60 to 69 years using the psychophysical forced-choice method. In this paradigm the volunteers had to decide which of two stimuli contained the above radial frequencies at low contrast levels. The other neutral stimulus was gray with homogeneous luminance. We detected a decline in contrast sensitivity for older adults at all radial frequencies compared to young adults. Also, contrast sensitivity for sine-wave gratings at all measured frequencies was better, as predicted, for all young adults. Maximum sensitivities in the radial frequency contrast sensitivity function and contrast sensitivity function occurred at 0.25 and 0.5 cycles per degree, respectively, for both young and older adults. These results suggest age-related changes in the contrast sensitivity function for concentric symmetrical stimuli.
Resumo:
Heart failure is a common endpoint for many forms of cardiovascular disease and a significant cause of morbidity and mortality. Chronic neurohumoral excitation (i.e., sympathetic hyperactivity) has been considered to be a hallmark of heart failure and is associated with a poor prognosis, cardiac dysfunction and remodeling, and skeletal myopathy. Aerobic exercise training is efficient in counteracting sympathetic hyperactivity and its toxic effects on cardiac and skeletal muscles. In this review, we describe the effects of aerobic exercise training on sympathetic hyperactivity, skeletal myopathy, as well as cardiac function and remodeling in human and animal heart failure. We also discuss the mechanisms underlying the effects of aerobic exercise training.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.
Resumo:
Le récepteur DcR3 (Decoy receptor 3) est un membre de la famille des récepteurs aux facteurs de nécrose tumorale (TNF). Il est fortement exprimé dans les tissus humains normaux ainsi que les tumeurs malignes. DcR3 est un récepteur pour trois ligands de la famille du TNF tels que FasL, LIGHT et TL1A. Étant une protéine soluble donc dépourvue de la portion transmembranaire et intracytoplasmique, le récepteur DcR3 est incapable d’effectuer une transduction de signal intracellulaire à la suite de son interaction avec ses ligands. De ce fait, DcR3 joue un rôle de compétiteur pour ces derniers, afin d’inhiber la signalisation via leurs récepteurs fonctionnels tels que Fas, HVEM/LTbetaR et DR3. Lors de nos précédentes études, nous avons pu démontrer, que DcR3 pouvaist moduler la fonction des cellules immunitaires, et aussi protéger la viabilité des îlots de Langerhans. À la suite de ces résultats, nous avons généré des souris DcR3 transgéniques (Tg) en utilisant le promoteur du gène β-actine humaine afin d’étudier plus amplement la fonction de ce récepteur. Les souris Tg DcR3 ont finalement développé le syndrome lupus-like (SLE) seulement après l’âge de 6 mois. Ces souris présentent une variété d'auto-anticorps comprenant des anticorps anti-noyaux et anti-ADN. Elles ont également manifesté des lésions rénales, cutanées, hépatiques et hématopoïétiques. Contrairement aux modèles de lupus murin lpr et gld, les souris DcR3 sont plus proche du SLE humain en terme de réponse immunitaire de type Th2 et de production d'anticorps d'anti-Sm. En péus, nous avons constaté que les cellules hématopoïétiques produisant DcR3 sont suffisantes pour causer ces pathologies. DcR3 peut agir en perturbant l’homéostasie des cellules T pour interférer avec la tolérance périphérique, et ainsi induire l'autoimmunité. Chez l'humain, nous avons détecté dans le sérum de patients SLE des niveaux élevés de la protéine DcR3. Chez certains patients, comme chez la souris, ces niveaux sont liés directement aux titres élevés d’IgE. Par conséquent, DcR3 peut représenter un facteur pathogénique important du SLE humain. L’étude des souris Tg DcR3, nous a permis aussi d’élucider le mécanisme de protection des îlots de Langerhans. Le blocage de la signalisation des ligands LIGHT et TL1A par DcR3 est impliqué dans une telle protection. D'ailleurs, nous avons identifié par ARN microarray quelques molécules en aval de cette interaction, qui peuvent jouer un rôle dans le mécanisme d’action. Nous avons par la suite confirmé que Adcyap1 et Bank1 joue un rôle critique dans la protection des îlots de Langerhans médiée par DcR3. Notre étude a ainsi élucidé le lien qui existe entre la signalisation apoptotique médiée par Fas/FasL et la pathogénèse du SLE humain. Donc, malgré l’absence de mutations génétiques sur Fas et FasL dans le cas de cette pathologie, DcR3 est capable de beoquer cette signalisation et provoquer le SLE chez l’humain. Ainsi, DcR3 peut simultanément interférer avec la signalisation des ligands LIGHT et TL1A et causer un phénotype plus complexe que les phénotypes résultant de la mutation de Fas ou de FasL chez certains patients. DcR3 peut également être utilisé comme paramètre diagnostique potentiel pour le SLE. Les découvertes du mécanisme de protection des îlots de Langerhans par DcR3 ouvrent la porte vers de nouveaux horizons afin d'explorer de nouvelles cibles thérapeutiques pour protéger la greffe d'îlots.
Resumo:
The attached file is created with Scientific Workplace Latex
Resumo:
We present an Overlapping Generations Model with two final goods: tradable goods are produced with a standard Cobb-Douglas production function and non-tradable goods are produced with linear production function where the only factor is labor. We maintain the fundamental assumption of factor mobility between sectors so model is consistent with the Balassa-Samuelson hypothesis. Given the general equilibrium structure of our model we can examine the effect of the saving rate on migration and non-tradable relative prices. Under this setting, we find that the elderly have incentives to migrate from economies where productivity is high to economies with low productivity because of the lower cost of living. In more general terms the elderly migration is likely to go from rich to poor countries. We also find that, for poor countries, the elderly migration has a positive effect in wages and capital accumulation.
Resumo:
The poliovirus cis-acting replication element (CRE) templates the uridylylation of VPg, the protein primer for genome replication. The CRE is a highly conserved structural RNA element in the enteroviruses and located within the polyprotein-coding region of the genome. We have determined the native structure of the CRE, defined the regions of the structure critical for activity, and investigated the influence of genomic location on function. Our results demonstrate that a 14-nucleotide unpaired terminal loop, presented on a suitably stable stem, is all that is required for function. These conclusions complement the recent analysis of the 14-nucleotide terminal loop in the CRE of human rhinovirus type 14. The CRE can be translocated to the 5' noncoding region of the genome, at least 3.7-kb distant from the native location, without adversely influencing activity, and CRE duplications do not adversely influence replication. We do not have evidence for a specific interaction between the CRE and the RNA-binding 3CD(pro) complex, an essential component of the uridylylation reaction, and the mechanism by which the CRE is coordinated and orientated during the reaction remains unclear. These studies provide a detailed overview of the structural determinants required for CRE function, and will facilitate a better understanding of the requirements for picornavirus replication.
Resumo:
Background: Aging is associated with reduced numbers of beneficial colonic bifidobacteria and impaired immunity. Galactooligosaccharides (GOSs) stimulate the growth of bifidobacteria in younger adults, but little is known about their effects in the elderly and their immunomodulatory capacity. Objective: We assessed the effect of a prebiotic GOS mixture (B-GOS) on immune function and fecal microflora composition in healthy elderly subjects. Design: In a double-blind, placebo-controlled, crossover study, 44 elderly subjects were randomly assigned to receive either a placebo or the B-GOS treatment (5.5 g/d). Subjects consumed the treatments for 10 wk, and then went through a 4-wk washout period, before switching to the other treatment for the final 10 wk. Blood and fecal samples were collected at the beginning, middle (5 wk), and end of the test period. Predominant bacterial groups were quantified, and phagocytosis, natural killer (NK) cell activity, cytokine production, plasma cholesterol, and HDL cholesterol were measured. Results: B-GOS significantly increased the numbers of beneficial bacteria, especially bifidobacteria, at the expense of less beneficial groups compared with the baseline and placebo. Significant increases in phagocytosis, NK cell activity, and the production of antiinflammatory cytokine interleukin-10 (IL-10) and significant reduction in the production of proinflammatory cytokines (IL-6, IL-1 beta , and tumor necrosis factor-alpha) were also observed. B-GOS exerted no effects on total cholesterol or HDL-cholesterol production, however. Conclusions: B-GOS administration to healthy elderly persons resulted in positive effects on both the microflora composition and the immune response. Therefore, B-GOS may be a useful dietary candidate for the enhancement of gastrointestinal health and immune function in elderly persons. Am J Clin Nutr 2008; 88: 1438-46.
Resumo:
The health benefits of green tea (Camellia sinensis) catechins are becoming increasingly recognised. Amongst the proposed benefits are the maintenance of endothelial function and vascular homeostasis and an associated reduction in atherogenesis and CVD risk. The mounting evidence for the influential effect of green tea catechins on vascular function from epidemiological, human intervention and animal studies is subject to review together with exploration of the potential mechanistic pathways involved. Epigallocatechin-3-gallate, one of the most abundant and widely studied catechin found in green tea, will be prominent in the present review. Since there is a substantial inconsistency in the published data with regards to the impact of green tea catechins on vascular function, evaluation and interpretation of the inter- and intra-study variability is included. In conclusion, a positive effect of green tea catechins on vascular function is becoming apparent. Further studies in animal and cell models using physiological concentrations of catechins and their metabolites are warranted in order to gain some insight into the physiology and molecular basis of the observed beneficial effects.