841 resultados para FORMING OLIGONUCLEOTIDES
Resumo:
Antisense oligonucleotides (ASOs) have the potential of revolutionizing medicine due to their ability to manipulate gene function for therapeutic purposes. ASOs are chemically modified and/or incorporated with nanoparticles to enhance their stability and cellular uptake; however, one of the biggest challenges is the poor understanding of their uptake mechanism, which is needed for designing better ASOs with high activity and low toxicity. Here, we study the uptake mechanism of three therapeutically relevant ASOs (peptide-conjugated phosphorodiamidate morpholino (P-PMO), 2?Omethyl phosphorothioate (2?OMe) and phosphorothioated tricyclo DNA (tcDNA) that have been optimized to induce exon skipping in models of Deuchenne muscular dystrophy (DMD). We show that P-PMO and tcDNA have high propensity to spontaneously self-assemble into nanoparticles. P-PMO forms micelles of defined size and their net charge (zeta potential) is dependent on the medium and concentration. In biomimetic conditions and at low concentrations P-PMO obtains net negative charge and its uptake is mediated by class A scavenger receptor subtypes (SCARAs) as shown by competitive inhibition and RNAi silencing experiments in-vitro. In-vivo, the activity of P-PMO was significantly decreased in SCARA1 knock-out mice compared to wild-type animals. Additionally, we show that SCARA1 is involved in the uptake of tcDNA and 2?OMe as shown by competitive inhibition and co-localization experiments. Surface plasmon resonance binding analysis to SCARA1 demonstrated that P-PMO and tcDNA have higher binding profiles to the receptor compared to 2?OMe. These results demonstrate receptor-mediated uptake for a range of ASO chemistries, a mechanism that is dependent on their self-assembly into nanoparticles.
Resumo:
A series of HeLa cell lines which stably express beta-globin pre-mRNAs carrying point mutations at nt 654, 705, or 745 of intron 2 has been developed. The mutations generate aberrant 5' splice sites and activate a common 3' cryptic splice site upstream leading to aberrantly spliced beta-globin mRNA. Antisense oligonucleotides, which in vivo blocked aberrant splice sites and restored correct splicing of the pre-mRNA, revealed major differences in the sensitivity of these sites to antisense probes. Although the targeted pre-mRNAs differed only by single point mutations, the effective concentrations of the oligonucleotides required for correction of splicing varied up to 750-fold. The differences among the aberrant 5' splice sites affected sensitivity of both the 5' and 3' splice sites; in particular, sensitivity of both splice sites was severely reduced by modification of the aberrant 5' splice sites to the consensus sequence. These results suggest large differences in splicing of very similar pre-mRNAs in vivo. They also indicate that antisense oligonucleotides may provide useful tools for studying the interactions of splicing machinery with pre-mRNA.
Resumo:
Histone RNA 3' processing in vitro produces one or more 5' cleavage products corresponding to the mature histone mRNA 3' end, and a group of 3' cleavage products whose 5' ends are mostly located several nucleotides downstream of the mRNA 3' end. The formation of these 3' products is coupled to the formation of 5' products and dependent on the U7 snRNP and a heat-labile processing factor. These short 3' products therefore are a true and general feature of the processing reaction. Identical 3' products are also formed from a model RNA containing all spacer nucleotides downstream of the mature mRNA 3' end, but no sequences from the mature mRNA. Again, this reaction is dependent on both the U7 snRNP and a heat-labile factor. Unlike the processing with a full-length histone pre-mRNA, this reaction produces only 3' but no 5' fragments. In addition, product formation is inhibited by addition of cap structures at the model RNA 5' end, indicating that product formation occurs by 5'-3' exonucleolytic degradation. This degradation of a model 3' product by a 5'-3' exonuclease suggests a mechanism for the release of the U7 snRNP after processing by shortening the cut-off histone spacer sequences base paired to U7 RNA.
Resumo:
Rolling Circle Amplification (RCA) is an isothermal enzymatic method generating single-stranded DNA products consisting of concatemers containing multiple copies of the reverse complement of the circular template precursor. Little is known on the compatibility of modified nucleoside triphosphates (dN*TPs) with RCA, which would enable the synthesis of long, fully modified ssDNA sequences. Here, dNTPs modified at any position of the scaffold were shown to be compatible with rolling circle amplification, yielding long (>1 kb), and fully modified single-stranded DNA products. This methodology was applied for the generation of long, cytosine-rich synthetic mimics of telomeric DNA. The resulting modified oligo-nucleotides displayed an improved resistance to fetal bovine serum.
Resumo:
Cancer is one of the most severe and widespread diseases and an ideal treatment has not yet been found. In the last decades, cisplatinum was commonly applied in cancer therapy with very good results. However, serious side effects and resistant tumors necessitated the development of new antineoplastic agents, such as metallocenes dihalides. These are metal-based compounds exhibiting two cyclopentadienyl ligands and a cis-dihalide motif. They resemble the cis-chloro configuration of cisplatinum, which propounds a similar mode of action. Metallocenes comprising one of the transition metals titanium, molybdenum, vanadium, niobium, and zirconium as the metal center have been shown to be effective against several cancer cell lines. Evidence for the accumulation of metallocenes in the nucleus implied that DNA is one of the major targets. Although several studies reported adduct formation of metallocenes with nuclear DNA, as yet substantial information about the general binding pattern and the binding to higher-order structures is lacking. Mass spectrometry can fill this gap as it constitutes a powerful technique to investigate the formation of organometallic adducts. Presented data demonstrate that the two agents titanocene dichloride and molybdenocene dichloride bind to single-stranded DNA and RNA. Distinct fragment ions formed upon collision-induced dissociation help to unravel preferential binding sites within the oligonucleotides. Moreover, adducts with duplexes and quadruplexes shed light on the molecular mechanism of action.
Resumo:
Metallocene dichlorides constitute a remarkable class of antineoplastic agents that are highly effective against several cancer cell lines. They were shown to accumulate in the DNA-rich region, which suggests DNA as the primary target. These compounds exhibit two cyclopentadienyl ligands and two labile halide ligands, resulting in a bent sandwich structure. The cis-dihalide motif is structurally related to the cis-chloro configuration of cisplatin and similar modes of action can thus be assumed. Cisplatin binds to two neighboring guanine nucleobases in DNA and consequently, distorts the double-helix, thereby inhibiting DNA replication and transcription. Platinum is classified as a soft Lewis acid and binds preferentially to the nitrogen atoms within the nucleobases. The metallocene dichlorides investigated in this study comprise the metal centers Ti, V, Nb, Mo, Hf, and W, which are classified as hard or intermediate Lewis acids, and thus, favor binding to the phosphate oxygen. Although several studies reported adduct formation of metallocene dichlorides with nucleic acids, substantial information about the adduct composition, the binding pattern, and the nucleobase selectivity has not been provided yet. ESI-MS analyses gave evidence for the formation of metallocene adducts (M = Ti, V, Mo, and W) with single-stranded DNA homologues at pH 7. No adducts were formed with Nb and Hf at neutral pH, albeit adducts with Nb were observed at a low pH. MS2 data revealed considerable differences of the adduct compositions. The product ion spectra of DNA adducts with hard Lewis acids (Ti, V) gave evidence for the loss of metallocene ligands and only moderate backbone fragmentation was observed. By contrast, adducts with intermediate Lewis acids (Mo, W) retained the hydroxy ligands. Preliminary results are in good agreement with the Pearson concept and DFT calculations. Since the metallodrugs were not lost upon CID, the nucleobase selectivity, stoichiometry, and binding patterns can be elucidated by means of tandem mass spectrometry.
Resumo:
The observation that the membranes of flagella are enriched in sterols and sphingolipids has led to the hypothesis that flagella might be enriched in raft-forming lipids. However, a detailed lipidomic analysis of flagellar membranes is not available. Novel protocols to detach and isolate intact flagella from Trypanosoma brucei procyclic forms in combination with reverse-phase liquid chromatography high-resolution tandem mass spectrometry allowed us to determine the phospholipid composition of flagellar membranes relative to whole cells. Our analyses revealed that phosphatidylethanolamine, phosphatidylserine, ceramide and the sphingolipids inositol phosphorylceramide and sphingomyelin are enriched in flagella relative to whole cells. In contrast, phosphatidylcholine and phosphatidylinositol are strongly depleted in flagella. Within individual glycerophospholipid classes, we observed a preference for ether-type over diacyl-type molecular species in membranes of flagella. Our study provides direct evidence for a preferential presence of raft-forming phospholipids in flagellar membranes of T. brucei.
Resumo:
• Regeneration of the dominant ectomycorrhizal tree Microberlinia bisulcata in groves in Korup, Central Africa, is very poor. The hypothesis was tested that this species is more shade intolerant than other co-occurring species. • In two 1-yr trials, each with M. bisulcata and four other species at a nursery close to Korup, growth was measured under five PAR levels, with ± added P and ± watering in the dry season. In parallel experiments the effects of PAR with two R : FR ratios were investigated. • Increasing PAR had a consistent effect on the rates of increase in plant mass and on changes in the other variables. Doubling soil P, watering and halving the R : FR ratio had almost no effect. However, across species, mass at low PAR and relative growth rate related positively and negatively, respectively, to seed mass. • One contributing factor for the poor recruitment of M. bisulcata is therefore its low survival and slow growth at low PAR, due to its small seed size. The two codominant ectomycorrhizal grove species of Tetraberlinia, with larger seeds, were less affected by low PAR.
Resumo:
Many biological processes depend on the sequential assembly of protein complexes. However, studying the kinetics of such processes by direct methods is often not feasible. As an important class of such protein complexes, pore-forming toxins start their journey as soluble monomeric proteins, and oligomerize into transmembrane complexes to eventually form pores in the target cell membrane. Here, we monitored pore formation kinetics for the well-characterized bacterial pore-forming toxin aerolysin in single cells in real time to determine the lag times leading to the formation of the first functional pores per cell. Probabilistic modeling of these lag times revealed that one slow and seven equally fast rate-limiting reactions best explain the overall pore formation kinetics. The model predicted that monomer activation is the rate-limiting step for the entire pore formation process. We hypothesized that this could be through release of a propeptide and indeed found that peptide removal abolished these steps. This study illustrates how stochasticity in the kinetics of a complex process can be exploited to identify rate-limiting mechanisms underlying multistep biomolecular assembly pathways.
Resumo:
We report on the in vitro effects of the bumped kinase inhibitor 1294 (BKI-1294) in cultures of virulent Neospora caninum isolates Nc-Liverpool (Nc-Liv) and Nc-Spain7 and in two strains of Toxoplasma gondii (RH and ME49), all grown in human foreskin fibroblasts. In these parasites, BKI-1294 acted with 50% inhibitory concentrations (IC50s) ranging from 20 nM (T. gondii RH) to 360 nM (N. caninum Nc-Liv), and exposure of intracellular stages to 1294 led to the nondisjunction of newly formed tachyzoites, resulting in the formation of multinucleated complexes similar to complexes previously observed in BKI-1294-treated N. caninum beta-galactosidase-expressing parasites. However, such complexes were not seen in a transgenic T. gondii strain that expressed CDPK1 harboring a mutation (G to M) in the gatekeeper residue. In T. gondii ME49 and N. caninum Nc-Liv, exposure of cultures to BKI-1294 resulted in the elevated expression of mRNA coding for the bradyzoite marker BAG1. Unlike in bradyzoites, SAG1 expression was not repressed. Immunofluorescence also showed that these multinucleated complexes expressed SAG1 and BAG1 and the monoclonal antibody CC2, which binds to a yet unidentified bradyzoite antigen, also exhibited increased labeling. In a pregnant mouse model, BKI-1294 efficiently inhibited vertical transmission in BALB/c mice experimentally infected with one of the two virulent isolates Nc-Liv or Nc-Spain7, demonstrating proof of concept that this compound protected offspring from vertical transmission and disease. The observed deregulated antigen expression effect may enhance the immune response during BKI-1294 therapy and will be the subject of future studies.
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Formation of a triple helix resulting from oligonucleotide binding to the DNA double helix offers new possibilities to control gene expression at the transcriptional level. Purine-motif triplexes can be formed under physiological pH. Nevertheless, this formation was inhibited by certain monovalent cations during the association but not during dissociation. Since triplexes are very stable, it was possible to assemble them in the absence of KCl and have them survive throughout the course of an in vitro transcription reaction. As for the design of a better triplex-forming oligonucleotide, 12 nucleotides in length afforded the highest binding affinity. G/T-rich oligonucleotides can be very polymorphic in solution. The conditions for forming purine-motif triplexes, duplexes or G-quartets were determined. Understanding these parameters will be important for the practical use of G-rich oligonucleotides in the development of DNA aptamers where the structure of the oligonucleotide is paramount in dictating its function. Finally, purine-motif triplexes were demonstrated to significantly inhibit gene transcription in vitro. The optimal effect on this process was dependent on the location of triplexes within the promoter, i.e., whether upstream or proximally downstream of the transcription start site. The mechanism for the inhibition of transcription appeared to be interference with initiation through preventing engagement by RNA polymerase. This finding is revolutionary when compared to the conventional model where triplexes inhibit transcription only by occluding binding by trans-acting proteins. Our findings broaden the utility of triplexes and support a strategy for antigene therapy by triplexes. ^