Molecular epidemiology of type 1 and 2 dengue viruses in Brazil from 1988 to 2001

Dengue is a mosquito-borne viral infection that in recent decades has become a major international public health concern. Epidemic dengue fever reemerged in Brazil in 1981. Since 1990 more than one dengue virus serotype has been circulating in this tropical country and increasing rates of dengue hemorrhagic fever and dengue shock syndrome have been detected every year. Some evidence supports the association between the introduction of a new serotype and/or genotype in a region and the appearance of dengue hemorrhagic fever. In order to study the evolutionary relationships and possible detection of the introduction of new dengue virus genotypes in Brazil in the last years, we analyzed partial nucleotide sequences of 52 Brazilian samples of both dengue type 1 and dengue type 2 isolated from 1988 to 2001 from highly endemic regions. A 240-nucleotide-long sequence from the envelope/nonstructural protein 1 gene junction was used for phylogenetic analysis. After comparing the nucleotide sequences originally obtained in this study to those previously studied by others, and analyzing the phylogenetic trees, we conclude that, after the initial introduction of the currently circulating dengue-1 and dengue-2 genotypes in Brazil, there has been no evidence of introduction of new genotypes since 1988. The increasing number of dengue hemorrhagic fever cases seen in Brazil in the last years is probably associated with secondary infections or with the introduction of new serotypes but not with the introduction of new genotypes.

Attenuation and immunogenicity of recombinant yellow fever 17D-dengue type 2 virus for rhesus monkeys

A chimeric yellow fever (YF)-dengue serotype 2 (dengue 2) virus was constructed by replacing the premembrane and envelope genes of the YF 17D virus with those from dengue 2 virus strains of Southeast Asian genotype. The virus grew to high titers in Vero cells and, after passage 2, was used for immunogenicity and attenuation studies in rhesus monkeys. Subcutaneous immunization of naive rhesus monkeys with the 17D-D2 chimeric virus induced a neutralizing antibody response associated with the protection of 6 of 7 monkeys against viremia by wild-type dengue 2 virus. Neutralizing antibody titers to dengue 2 were significantly lower in YF-immune animals than in YF-naive monkeys and protection against challenge with wild-type dengue 2 virus was observed in only 2 of 11 YF-immune monkeys. An anamnestic response to dengue 2, indicated by a sharp increase of neutralizing antibody titers, was observed in the majority of the monkeys after challenge with wild-type virus. Virus attenuation was demonstrated using the standard monkey neurovirulence test. The 17D-D2 chimera caused significantly fewer histological lesions than the YF 17DD virus. The attenuated phenotype could also be inferred from the limited viremias compared to the YF 17DD vaccine. Overall, these results provide further support for the use of chimeric viruses for the development of a new live tetravalent dengue vaccine.

Diversity among satellite glial cells in dorsal root ganglia of the rat

Peripheral glial cells consist of satellite, enteric glial, and Schwann cells. In dorsal root ganglia, besides pseudo-unipolar neurons, myelinated and nonmyelinated fibers, macrophages, and fibroblasts, satellite cells also constitute the resident components. Information on satellite cells is not abundant; however, they appear to provide mechanical and metabolic support for neurons by forming an envelope surrounding their cell bodies. Although there is a heterogeneous population of neurons in the dorsal root ganglia, satellite cells have been described to be a homogeneous group of perineuronal cells. Our objective was to characterize the ultrastructure, immunohistochemistry, and histochemistry of the satellite cells of the dorsal root ganglia of 17 adult 3-4-month-old Wistar rats of both genders. Ultrastructurally, the nuclei of some satellite cells are heterochromatic, whereas others are euchromatic, which may result from different amounts of nuclear activity. We observed positive immunoreactivity for S-100 and vimentin in the cytoplasm of satellite cells. The intensity of S-100 protein varied according to the size of the enveloped neuron. We also noted that vimentin expression assumed a ring-like pattern and was preferentially located in the cytoplasm around the areas stained for S-100. In addition, we observed nitric oxide synthase-positive small-sized neurons and negative large-sized neurons equal to that described in the literature. Satellite cells were also positive for NADPH-diaphorase, particularly those associated with small-sized neurons. We conclude that all satellite cells are not identical as previously thought because they have different patterns of glial marker expression and these differences may be correlated with the size and function of the neuron they envelope.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Characterization and Investigation on Material Compatibilities of Building Integrated Photovoltaic Module Components

Building Integrated Photovoltaics (BIPV) are considered as the future of photovoltaic (PV) technology. The advantage of BIPV system is its multi-functionality; they fulfil the functions of a building envelope with the added benefit of generating power by replacing the traditional roofing and façade materials with PV that generate power. In this thesis, different types of PV cells and modules have been described in detail with their efficiencies and usage trends in the last decade. The different BIPV products for roof and façade are discussed in detail giving several examples. The electricity generation potential of BIPV in selected countries is compared with their actual electricity consumption. Further, the avoided greenhouse gas (GHG) emissions associated with electricity generation from traditional sources and transportation and distribution (T&D) losses are calculated. The results illustrate huge savings in GHGs. In BIPV different types of façade and backsheets are used. In this thesis, selected backsheets and façade were characterized in terms of their surface structure identification using infrared spectroscopy (FTIR-ATR), scanning electron microscopy with energy dispersive X-ray (SEM-EDX) and physical characterization using surface energy measurements. By using FTIR-ATR, surface polymeric materials were identified and with SEM-EDX, identification of the surface elements was possible. Surface energy measurements were useful in finding the adhesives and knowing the surface energies of the various backsheets and façade. The strength of adhesion between the facade and backsheets was studied using peel test. Four different types of adhesives were used to study the fracture pattern and peel tests values to identify the most suitable adhesive. It was found out that pretreatment increased the adhesive strength significantly.

Rakennukseen integroitavien aurinkosähköjärjestelmien soveltuvuus pohjoismaisiin olosuhteisiin

Tässä työssä esitellään aurinkosähköjärjestelmien rakenne, toiminta ja niille sopivia käyttökohteita. Työn tavoitteena on arvioida teknillistaloudellisesti rakennukseen integroitujen aurinkosähköjärjestelmien soveltuvuutta Pohjoismaisiin olosuhteisiin. Tekninen arviointi toteutetaan pohjautuen kirjallisuuteen, käytännön analysointiin ja simuloituihin tuloksiin. Taloudellinen arviointi sisältää lisäksi myös laskennallista analysointia. Aurinkosähköjärjestelmän toiminnan arvioinnissa päädyttiin hyödyntämään aiemmin aurinkosähköjärjestelmien suorituskyvystä julkaistuja materiaaleja. Käytössä olevien resurssien rajallisuus ei mahdollistanut tarpeeksi laajamittaisten suorituskykytestien toteuttamista. Teknisen arvioinnin perusteella saatiin selville merkittävimpien tekijöiden vaikutus rakennukseen integroitujen aurinkosähköjärjestelmien toimintaan. Teknillistaloudellisen arvioinnin perusteella julkisivumateriaalien korvaaminen aurinkopaneeleilla tulee harkita tapauskohtaisesti. Työ sisältää myös katsauksen olemassa olevista teknisistä ratkaisuista.

Amacy Matthews Letters, 1918

The correspondence is dated October 19, 1918 and December 17, 1918. Amacy Matthews was the treasurer for the Township of Crowland. The correspondence is from J.W. [John Wells] Marshall, the county school inspector and relates to payments to be made to each teacher listed in the correspondence. Each letter includes the signature of the teacher acknowledging receipt of the funds. Teachers listed are Orlin McKenney, Edward Farr, Leonard Matthews, Charles Terreberry, Hiram Pratt, William VanAlstine, Grant Jenkinson and Harry Terreberry.

Commemorative stamps, United States, 1948.

Consists of 4 cancelled stamps on an envelope addressed to Mr. Oscar Stein, Greenwood Lake, N.Y. The envelope is postmarked August 2, 1948, Niagara Falls, New York.

Commemorative stamps, British, American and Canadian, 1974-1977, 1982-1984, 1996.

The Guernsey post office stamps consist of 2 exhibition series souvenir sheets commemorating Major-General Sir Issac Brock, 1769-1812. The stamp was issued in 1996 to celebrate Guernsey’s attendance at Canada’s international stamp exhibition CAPEX 96. The stamps issued by the United States postal service consist of 1 sheet of stamps commemorating the 50th anniversary of the Peace Bridge, 1927-1977. The stamps issued by Canada Post include 5 commemorative day-of-issue envelopes with stamps featuring William Hamilton Merritt and the Welland Canal. This stamp was issued in 1974 to celebrate the 150th anniversary of the canal. There is also a set of 4 inscription corner blocks of stamps. These items are contained in an envelope addressed to Mr. J.N. Jackson, St. Catharines, ON. There is also a separate sheet of the same stamp. Also issued by Canada Post are 2 full sheets of stamps, one commemorating the 50th anniversary of the Peace Bridge (1927-1977), and one commemorating 25 years of the St. Lawrence Seaway (1959-1984). Lastly, there are 2 full sheets of stamps commemorating the 100th anniversary of the Royal Henley Regatta, issued in 1982.

Marriage Certificate - Hamilton K. Woodruff and Julia C. Cleveland

The marriage certificate of Mr. Hamilton K. Woodruff of St. Catharines and Miss Julia C. Cleveland of Erie, Pennsylvania. This is certificate no. 5221 signed by James C. Wilson. This is accompanied by 2 envelopes; one envelope is from Henry L. Rea, clerk of courts, Erie Pennsylvania to Mr. H. K. Woodruff, the other envelope just says "marriage certificate Mrs. H. K. Woodruff", Nov. 21, 1894.

Marriage Certificate Card - Percy Carruthers Band and Margaret Julia Woodruff

A marriage certificate card stating that Percy Carruthers Band and Margaret Julia Woodruff were married in St. Catharines with envelope which has the return address: James Carruthers and Company, Ltd., Grain Exporters, Produce Exchange Building, New York, November 25, 1919.

Mallard Duck Feathers

These feathers are enclosed in an envelope which has "Sam D. Woodruff, Water Commissioner, City" written on the front.

Indenture between Hamilton Killaly Woodruff and the United States Trust Company of New York (3rd Trust Deed)

Indenture between Hamilton Killaly Woodruff and the United States Trust Company of New York. This is listed as the 3rd trust deed. The proceeds would be paid to successors (2 copies). Most of the first page of copy no. 2 is torn away which does affect the text. These 2 documents are in an envelope marked "vouchers", June 20, 1899.

Letter - J.M. Crysler to H.K. Woodruff

Letter to H.K. Woodruff from J.M. Crysler, secretary treasurer of the St. David’s cemetery committee. He received Mr. Woodruff’s cheque to put the lots in proper condition and spoke to Rigg Brothers of Niagara Falls regarding markers for the graves of Ezekiel and Sally Woodruff. This letter is accompanied by an envelope, Mar. 13, 1922.

Invitation to the Funeral of Infant Henry Howard Woodruff

Invitation to the funeral of infant Henry Howard Woodruff on March 17, 1868. He was the son of Henry and Emma Woodruff. This is accompanied by an envelope. March 16, 1868.