The regulation and function of collagenase-3 (MMP-13) in cutaneous wound healing and squamous cell carcinoma

Matrix metalloproteinase-13 (MMP-13) is a potent proteolytic enzyme, whose expression has been previously associated with fetal bone development and postnatal bone remodeling and with adult gingival wound healing. MMP-13 is also known to be involved in the growth and invasion of various cancers including squamous cell carcinoma (SCC) of the skin. The aim of this study was to further elucidate the function and regulation of MMP-13 in wound repair and cancer. In this study, it was shown that fetal skin fibroblasts express MMP-13 in response to transforming growth factor-β in a p38 MAP kinase dependent manner. In addition, MMP-13 was found to be expressed in vivo by wound fibroblasts in human fetal skin grafted on SCID mice. Adenovirally delivered expression of MMP-13 enhanced collagen matrix contraction by fibroblasts in vitro in association with altered cytoskeletal structure, enhanced proliferation and survival. These results indicate that MMP-13 is involved in cell-mediated collagen matrix remodeling and suggest a role for MMP-13 in superior matrix remodeling and scarless healing of fetal skin wounds. Using an MMP-13 deficient mouse strain, it was shown that MMP-13 is essential for the normal development of experimental granulation tissue in mice. MMP-13 was implicated in the regulation of myofibroblast function and angiogenesis and the expression of genes involved in cellular proliferation and movement, immune response, angiogenesis and proteolysis. Finally, epidermal mitogen, keratinocyte growth factor (KGF) was shown to suppress the malignant properties of skin SCC cells by downregulating the expression of several target genes with potential cancer promoting properties, including MMP-13, and by reducing SCC cell invasion. These results provide evidence that MMP-13 potently regulates cell viability, myofibroblast function and angiogenesis associated with wound healing and cancer. In addition, fibroblasts expressing MMP-13 show high collagen reorganization capacity. Moreover, the results suggest that KGF mediates the anti-cancer effects on skin SCC

Hypothalamic-pituitary-gonadal function in men with liver cirrhosis before and after liver transplantation

Objective: To evaluate the influence of end-stage liver disease and orthotopic liver transplantation in the pituitary function and hormone metabolism before and after liver transplantation.Methods: In a prospective study, serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2) and prolactin (PRL) of 30 male patients with cirrhosis were determined two to four hours before and six months after liver transplantation. The results were compared according to the Model for End-stage Liver Disease (MELD).Results: male patients with liver cirrhosis have hypogonadism. FSH was normal, but inappropriately low due to androgen failure; E2 and PRL, on their turn, were high. After liver transplantation, FSH and LH levels increased (p < 0.05), whereas E2 and PRL normalized (p < 0.05). The MELD score did not influence changes in FSH, PRL and LH, however, the more severe the cirrhosis was, the more significant was the normalization of E2 (p = 0.01).Conclusion: Patients with cirrhosis and male hypogonadism have inappropriately normal levels of FSH and LH, associated with an increase in E2 and LRP. After liver transplantation, FSH and LH increased, while E2 and PRL returned to normal. Changes in E2 levels were most pronounced in patients with MELD > 18. The severity of cirrhosis had no influence on FSH, PRL and LH.

Calculation of breed direct and maternal genetic fractions and breed specific direct and maternal heterozygosity for crossbreeding data

Teaching, research, and herd breeding applications may require calculation of breed additive contributions for direct and maternal genetic effects and fractions of heterozygosity associated with breed specific direct and maternal heterosis effects. These coefficients can be obtained from the first NB rows of a pseudo numerator relationship matrix where the first NB rows represent fractional contributions by breed to each animal or group representing a specific breed cross. The table begins with an NB x NB identity matrix representing pure breeds. Initial animals or representative crosses must be purebreds or two-breed crosses. Parents of initial purebreds are represented by the corresponding column and initial two-breed cross progeny by the two corresponding columns of the identity matrix. After that, usual rules are used to calculate the NB column entries corresponding to breeds for each animal. The NB entries are fractions of genes expected to be contributed by each of the pure breeds and correspond to the breed additive direct fractions. Entries in the column corresponding to the dam represent breed additive maternal fractions. Breed specific direct heterozygosity coefficients are entries of an NB x NB matrix formed by the outer product of the two NB by 1 columns associated with sire and dam of the animal. One minus sum of the diagonals represents total direct heterozygosity. Similarly, the NB x NB matrix formed by the outer product of columns associated with sire of dam and dam of dam contains breed specific maternal heterozygosity coefficients. These steps can be programmed to create covariates to merge with data. If X represents these coefficients for all unique breed crosses, then the reduced row echelon form function of MATLAB or SAS can be used on X to determine estimable functions of additive breed direct and maternal effects and breed specific direct and maternal heterosis effects

Structure and function of the cystic fibrosis transmembrane conductance regulator

Cystic fibrosis (CF) is a lethal autosomal recessive genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR). Mutations in the CFTR gene may result in a defective processing of its protein and alter the function and regulation of this channel. Mutations are associated with different symptoms, including pancreatic insufficiency, bile duct obstruction, infertility in males, high sweat Cl-, intestinal obstruction, nasal polyp formation, chronic sinusitis, mucus dehydration, and chronic Pseudomonas aeruginosa and Staphylococcus aureus lung infection, responsible for 90% of the mortality of CF patients. The gene responsible for the cellular defect in CF was cloned in 1989 and its protein product CFTR is activated by an increase of intracellular cAMP. The CFTR contains two membrane domains, each with six transmembrane domain segments, two nucleotide-binding domains (NBDs), and a cytoplasmic domain. In this review we discuss the studies that have correlated the role of each CFTR domain in the protein function as a chloride channel and as a regulator of the outwardly rectifying Cl- channels (ORCCs).

Adaptive Markov chain Monte Carlo and Bayesian filtering for state space models

This thesis is concerned with the state and parameter estimation in state space models. The estimation of states and parameters is an important task when mathematical modeling is applied to many different application areas such as the global positioning systems, target tracking, navigation, brain imaging, spread of infectious diseases, biological processes, telecommunications, audio signal processing, stochastic optimal control, machine learning, and physical systems. In Bayesian settings, the estimation of states or parameters amounts to computation of the posterior probability density function. Except for a very restricted number of models, it is impossible to compute this density function in a closed form. Hence, we need approximation methods. A state estimation problem involves estimating the states (latent variables) that are not directly observed in the output of the system. In this thesis, we use the Kalman filter, extended Kalman filter, Gauss–Hermite filters, and particle filters to estimate the states based on available measurements. Among these filters, particle filters are numerical methods for approximating the filtering distributions of non-linear non-Gaussian state space models via Monte Carlo. The performance of a particle filter heavily depends on the chosen importance distribution. For instance, inappropriate choice of the importance distribution can lead to the failure of convergence of the particle filter algorithm. In this thesis, we analyze the theoretical Lᵖ particle filter convergence with general importance distributions, where p ≥2 is an integer. A parameter estimation problem is considered with inferring the model parameters from measurements. For high-dimensional complex models, estimation of parameters can be done by Markov chain Monte Carlo (MCMC) methods. In its operation, the MCMC method requires the unnormalized posterior distribution of the parameters and a proposal distribution. In this thesis, we show how the posterior density function of the parameters of a state space model can be computed by filtering based methods, where the states are integrated out. This type of computation is then applied to estimate parameters of stochastic differential equations. Furthermore, we compute the partial derivatives of the log-posterior density function and use the hybrid Monte Carlo and scaled conjugate gradient methods to infer the parameters of stochastic differential equations. The computational efficiency of MCMC methods is highly depend on the chosen proposal distribution. A commonly used proposal distribution is Gaussian. In this kind of proposal, the covariance matrix must be well tuned. To tune it, adaptive MCMC methods can be used. In this thesis, we propose a new way of updating the covariance matrix using the variational Bayesian adaptive Kalman filter algorithm.

Aerobic exercise training in heart failure: impact on sympathetic hyperactivity and cardiac and skeletal muscle function

Heart failure is a common endpoint for many forms of cardiovascular disease and a significant cause of morbidity and mortality. Chronic neurohumoral excitation (i.e., sympathetic hyperactivity) has been considered to be a hallmark of heart failure and is associated with a poor prognosis, cardiac dysfunction and remodeling, and skeletal myopathy. Aerobic exercise training is efficient in counteracting sympathetic hyperactivity and its toxic effects on cardiac and skeletal muscles. In this review, we describe the effects of aerobic exercise training on sympathetic hyperactivity, skeletal myopathy, as well as cardiac function and remodeling in human and animal heart failure. We also discuss the mechanisms underlying the effects of aerobic exercise training.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Histopathological analysis of pre-implantation donor kidney biopsies: association with graft survival and function in one year post-transplantation

Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.

The role of DcR3 in systemic lupus erythematosus and islet β-Cell viability and function

Le récepteur DcR3 (Decoy receptor 3) est un membre de la famille des récepteurs aux facteurs de nécrose tumorale (TNF). Il est fortement exprimé dans les tissus humains normaux ainsi que les tumeurs malignes. DcR3 est un récepteur pour trois ligands de la famille du TNF tels que FasL, LIGHT et TL1A. Étant une protéine soluble donc dépourvue de la portion transmembranaire et intracytoplasmique, le récepteur DcR3 est incapable d’effectuer une transduction de signal intracellulaire à la suite de son interaction avec ses ligands. De ce fait, DcR3 joue un rôle de compétiteur pour ces derniers, afin d’inhiber la signalisation via leurs récepteurs fonctionnels tels que Fas, HVEM/LTbetaR et DR3. Lors de nos précédentes études, nous avons pu démontrer, que DcR3 pouvaist moduler la fonction des cellules immunitaires, et aussi protéger la viabilité des îlots de Langerhans. À la suite de ces résultats, nous avons généré des souris DcR3 transgéniques (Tg) en utilisant le promoteur du gène β-actine humaine afin d’étudier plus amplement la fonction de ce récepteur. Les souris Tg DcR3 ont finalement développé le syndrome lupus-like (SLE) seulement après l’âge de 6 mois. Ces souris présentent une variété d'auto-anticorps comprenant des anticorps anti-noyaux et anti-ADN. Elles ont également manifesté des lésions rénales, cutanées, hépatiques et hématopoïétiques. Contrairement aux modèles de lupus murin lpr et gld, les souris DcR3 sont plus proche du SLE humain en terme de réponse immunitaire de type Th2 et de production d'anticorps d'anti-Sm. En péus, nous avons constaté que les cellules hématopoïétiques produisant DcR3 sont suffisantes pour causer ces pathologies. DcR3 peut agir en perturbant l’homéostasie des cellules T pour interférer avec la tolérance périphérique, et ainsi induire l'autoimmunité. Chez l'humain, nous avons détecté dans le sérum de patients SLE des niveaux élevés de la protéine DcR3. Chez certains patients, comme chez la souris, ces niveaux sont liés directement aux titres élevés d’IgE. Par conséquent, DcR3 peut représenter un facteur pathogénique important du SLE humain. L’étude des souris Tg DcR3, nous a permis aussi d’élucider le mécanisme de protection des îlots de Langerhans. Le blocage de la signalisation des ligands LIGHT et TL1A par DcR3 est impliqué dans une telle protection. D'ailleurs, nous avons identifié par ARN microarray quelques molécules en aval de cette interaction, qui peuvent jouer un rôle dans le mécanisme d’action. Nous avons par la suite confirmé que Adcyap1 et Bank1 joue un rôle critique dans la protection des îlots de Langerhans médiée par DcR3. Notre étude a ainsi élucidé le lien qui existe entre la signalisation apoptotique médiée par Fas/FasL et la pathogénèse du SLE humain. Donc, malgré l’absence de mutations génétiques sur Fas et FasL dans le cas de cette pathologie, DcR3 est capable de beoquer cette signalisation et provoquer le SLE chez l’humain. Ainsi, DcR3 peut simultanément interférer avec la signalisation des ligands LIGHT et TL1A et causer un phénotype plus complexe que les phénotypes résultant de la mutation de Fas ou de FasL chez certains patients. DcR3 peut également être utilisé comme paramètre diagnostique potentiel pour le SLE. Les découvertes du mécanisme de protection des îlots de Langerhans par DcR3 ouvrent la porte vers de nouveaux horizons afin d'explorer de nouvelles cibles thérapeutiques pour protéger la greffe d'îlots.

CD40 signalling in platelet function

Le CD40 est un membre de la famille des récepteurs du facteur de nécrose tumorale ("Tumour necrosis factor", TNF), initialement identifié sur des cellules de carcinome de la vessie. L'interaction du CD40 avec son ligand (CD40L) est d'une importance cruciale pour le développement des cellules B et de la commutation d'isotype au cours de la réponse immunitaire acquise. L'expression du complexe CD40/CD40L était initialement cru d'être limiter aux cellules du système immunitaire, mais aujourd'hui il est bien connu que ce complexe est également exprimé sur les cellules du système circulatoire et vasculaire, et est impliqué dans diverses réactions inflammatoires; de sorte que le CD40L est maintenant considéré comme une molécule thrombo-inflammatoire prédictive des événements cardiovasculaires. Les plaquettes expriment constitutivement le CD40, alors que le CD40L n'est exprimé que suite à leur l'activation. Il est ensuite clivé en sa forme soluble (sCD40L) qui représente la majorité du sCD40L en circulation. Il fut démontré que le sCD40L influence l'activation plaquettaire mais son effet exact sur la fonction plaquettaire, ainsi que les mécanismes cellulaires et moléculaires sous-jacents à son action demeurent inconnus. Ainsi, ce projet a été entrepris dans le but d’adresser les objectifs spécifiques suivants: 1) évaluer les effets in vitro du sCD40L sur l'activation et l'agrégation plaquettaire; 2) identifier les récepteurs plaquettaires impliqués dans l’action du sCD40L; 3) élucider les voies signalétiques intracellulaires induits par le sCD40L; 4) évaluer les effets du sCD40L sur la formation de thrombus in vivo. Nous avons trouvé que le sCD40L augmente fortement l'activation et l'agrégation des plaquettes en réponse à de faibles concentrations d'agonistes. Les plaquettes humaines traitées avec une forme mutante du sCD40L qui n'interagit pas avec le CD40, et les plaquettes de souris déficientes en CD40 ne furent pas en mesure d'induire de telles réponses, indiquant que le récepteur principal du sCD40L au niveau des plaquettes est le CD40. En plus, nous avons identifié la présence de plusieurs membres de la famille du facteur associé du récepteur du TNF ("TNF receptor-associated factor", TRAF) dans les plaquettes et nous avons montré que seulement le TRAF2 s'associe avec le CD40 suite à la stimulation par le sCD40L. Nos résultats indiquent aussi que le sCD40L agisse sur les plaquettes au repos par l'entremise de deux voies signalétiques distinctes. La première voie implique l'activation de la petite GTPase Rac1 et de sa cible en aval, soit la protéine kinase p38 activée par le mitogène ("p38 mitogen-activated protein kinase", p38 MAPK ), menant au changement de forme plaquettaire et à la polymérisation de l'actine; alors que la deuxième voie implique l'activation de la cascade signalétique du NF-kB. Par ailleurs, à la suite d'une lésion artérielle induite par le chlorure de fer, le sCD40L exacerbe la formation de thrombus et l'infiltration leucocytaire au sein du thrombus dans les souris du type sauvage, mais pas chez les souris déficientes en CD40. En conclusion, ce projet a permis d'identifier pour la première fois deux voies signalétiques distinctes en aval du CD40 plaquettaire et a permis d'établir leur implication dans l'activation et l'agrégation plaquettaire en réponse au sCD40L. De manière plus importante, ce projet nous a permis d'établir un lien direct entre les niveaux élevés du sCD40L circulant et la formation de thrombus in vivo, tout en soulignant l'importance du CD40 dans ce processus. Par conséquent, l'axe CD40/CD40L joue un rôle important dans l'activation des plaquettes, les prédisposant à une thrombose accrue en réponse à une lésion vasculaire. Ces résultats peuvent expliquer en partie la corrélation entre les taux circulants élevés du sCD40L et l'incidence des maladies cardiovasculaires.

Characterization of Probability Distributions Using the Residual Entropy Function

The present study on the characterization of probability distributions using the residual entropy function. The concept of entropy is extensively used in literature as a quantitative measure of uncertainty associated with a random phenomenon. The commonly used life time models in reliability Theory are exponential distribution, Pareto distribution, Beta distribution, Weibull distribution and gamma distribution. Several characterization theorems are obtained for the above models using reliability concepts such as failure rate, mean residual life function, vitality function, variance residual life function etc. Most of the works on characterization of distributions in the reliability context centers around the failure rate or the residual life function. The important aspect of interest in the study of entropy is that of locating distributions for which the shannon’s entropy is maximum subject to certain restrictions on the underlying random variable. The geometric vitality function and examine its properties. It is established that the geometric vitality function determines the distribution uniquely. The problem of averaging the residual entropy function is examined, and also the truncated form version of entropies of higher order are defined. In this study it is established that the residual entropy function determines the distribution uniquely and that the constancy of the same is characteristics to the geometric distribution

Chemical Evaluation of Selected Organics and Trace Metals in the Mangrove Macroflora Of Cochin

Mangroves are considered to play a significant role in global carbon cycling. Themangrove forests would fix CO2 by photosynthesis into mangrove lumber and thus decrease the possibility of a catastrophic series of events - global warming by atmospheric CO2, melting of the polar ice caps, and inundation of the great coastal cities of the world. The leaf litter and roots are the main contributors to mangrove sediments, though algal production and allochthonous detritus can also be trapped (Kristensen et al, 2008) by mangroves due to their high organic matter content and reducing nature are excellent metal retainers. Environmental pollution due to metals is of major concern. This is due to the basic fact that metals are not biodegradable or perishable the way most organic pollutants are. While most organic toxicants can be destroyed by combustion and converted into compounds such as C0, C02, SOX, NOX, metals can't be destroyed. At the most the valance and physical form of metals may change. Concentration of metals present naturally in air, water and soil is very low. Metals released into the environment through anthropogenic activities such as burning of fossils fuels, discharge of industrial effluents, mining, dumping of sewage etc leads to the development of higher than tolerable or toxic levels of metals in the environment leading to metal pollution. Of course, a large number of heavy metals such as Fe, Mn, Cu, Ni, Zn, Co, Cr, Mo, and V are essential to plants and animals and deficiency of these metals may lead to diseases, but at higher levels, it would lead to metal toxicity. Almost all industrial processes and urban activities involve release of at least trace quantities of half a dozen metals in different forms. Heavy metal pollution in the environment can remain dormant for a long time and surface with a vengeance. Once an area gets toxified with metals, it is almost impossible to detoxify it. The symptoms of metal toxicity are often quite similar to the symptoms of other common diseases such as respiratory problems, digestive disorders, skin diseases, hypertension, diabetes, jaundice etc making it all the more difficult to diagnose metal poisoning. For example the Minamata disease caused by mercury pollution in addition to affecting the nervous system can disturb liver function and cause diabetes and hypertension. The damage caused by heavy metals does not end up with the affected person. The harmful effects can be transferred to the person's progenies. Ironically heavy metal pollution is a direct offshoot of our increasing ability to mass produce metals and use them in all spheres of existence. Along with conventional physico- chemical methods, biosystem approachment is also being constantly used for combating metal pollution

Not the outside but the inside matters : functional analysis of Capricious and Tartan during Drosophila tracheal morphogenesis

The tubular structures, which transport essential gases, liquids, or cells from one site to another, are shared among various divergent organisms. These highly organized tubular networks include lung, kidney, vasculature and mammary gland in mammals as well as trachea and salivary gland in Drosophila melanogaster. Many questions regarding the tubular morphogenesis cannot be addressed sufficiently by investigating the mammalian organs because their structures are extremely complex and therefore, systematic analyses of genetic and cellular programs guiding the development is not possible. In contrast, the Drosophila tracheal development provides an excellent model system since many molecular markers and powerful tools for genetic manipulations are available. Two mechanisms were shown to be important for the outgrowth of tracheal cells: the FGF signaling pathway and the interaction between the tracheal cells and the surrounding mesodermal cells. The Drosophila FGF ligand encoded by branchless (bnl) is localized in groups of cells near tracheal metameres. The tracheal cells expressing the FGF receptor breathless (btl) respond to these sources of FGF ligand and extend towards them. However, this FGF signaling pathway is not sufficient for the formation of continuous dorsal trunk, the only muticellular tube in tracheal system. Recently, it was found out that single mesodermal cells called bridge-cells are essential for the formation of continuous dorsal trunk as they direct the outgrowth of dorsal trunk cells towards the correct targets. The results in this PhD thesis demonstrate that a cell adhesion molecule Capricious (Caps), which is specifically localized on the surface of bridge-cells, plays an essential role in guiding the outgrowing dorsal trunk cells towards their correct targets. When caps is lacking, some bridge-cells cannot stretch properly towards the adjacent posterior tracheal metameres and thus fail to interconnect the juxtaposing dorsal trunk cells. Consequently, discontinuous dorsal trunks containing interruptions at several positions are formed. On the other hand, when caps is ectopically expressed in the mesodermal cells through a twi-GAL4 driver, these mesodermal cells acquire a guidance function through ectopic caps and misguide the outgrowing dorsal trunk cells in abnormal directions. As a result, disconnected dorsal trunks are formed. These loss- and gain-of-function studies suggest that Caps presumably establishes the cell-to-cell contact between the bridge-cells and the tracheal cells and thereby mediates directly the guidance function of bridge-cells. The most similar protein known to Caps is another cell adhesion molecule called Tartan (Trn). Interestingly, trn is expressed in the mesodermal cells but not in the bridge-cells. When trn is lacking, the outgrowth of not only the dorsal trunks but also the lateral trunks are disrupted. However, in contrast to the ectopic expression of caps, the misexpression of trn does not affect tracheal development. Whereas Trn requires only its extracellular domain to mediate the matrix function, Caps requires both its extracellular and intracellular domains to function as a guidance molecule in the bridge-cells. These observations suggest that Trn functions differently from Caps during tracheal morphogenesis. Presumably, Trn mediates a matrix function of mesodermal cells, which support the tracheal cells to extend efficiently through the surrounding mesodermal tissue. In order to determine which domains dictate the functional specificity of Caps, two hybrid proteins CapsEdTrnId, which contains the Caps extracellular domain and the Trn intracellular domain, and TrnEdCapsId, which consists of the Trn extracellular domain and the Caps intracellular domain, were constructed. Gain of function and rescue experiments with these hybrid proteins suggest on one hand that the extracellular domains of Caps and Trn are functionally redundant and on the other hand that the intracellular domain dictates the functional specificity of Caps. In order to identify putative interactors of Caps, yeast two-hybrid screening was performed. An in vivo interaction assay in yeast suggests that Ras64B interacts specifically with the Caps intracellular domain. In addition, an in vitro binding assay reveals a direct interaction between an inactive form of Ras64B and the Caps intracellular domain. ras64B, which encodes a small GTPase, is expressed in the mesodermal cells concurrently as caps. Finally, a gain-of-function study with the constitutively active Ras64B suggests that Ras64B presumably functions downstream of Caps. All these results suggest consistently that the small GTPase Ras64B binds specifically to the Caps intracellular domain and may thereby mediate the guidance function of Caps.

Approximate Approximations and a Boundary Point Method for the Linearized Stokes System

The method of approximate approximations, introduced by Maz'ya [1], can also be used for the numerical solution of boundary integral equations. In this case, the matrix of the resulting algebraic system to compute an approximate source density depends only on the position of a finite number of boundary points and on the direction of the normal vector in these points (Boundary Point Method). We investigate this approach for the Stokes problem in the whole space and for the Stokes boundary value problem in a bounded convex domain G subset R^2, where the second part consists of three steps: In a first step the unknown potential density is replaced by a linear combination of exponentially decreasing basis functions concentrated near the boundary points. In a second step, integration over the boundary partial G is replaced by integration over the tangents at the boundary points such that even analytical expressions for the potential approximations can be obtained. In a third step, finally, the linear algebraic system is solved to determine an approximate density function and the resulting solution of the Stokes boundary value problem. Even not convergent the method leads to an efficient approximation of the form O(h^2) + epsilon, where epsilon can be chosen arbitrarily small.

Institutions, Behavior and Evolution

The three articles constituting this thesis are for reasons of content or method related to the following three fields in economics: Behavioral Economics, Evolutionary Game Theory and Formal Institutional Economics. A core element of these fields is the concept of individual preferences. Preferences are of central importance for the conceptional framework to analyze human behavior. They form the foundation for the theory of rational choice which is defined by the determination of the choice set and the selection of the most preferred alternative according to some consistency requirements. The theory of rational choice is based on a very simplified description of the problem of choice (object function and constraints). However, that choices depend on many more factors is for instance propagated by psychological theories and is supported by many empirical and experimental studies. This thesis adds to a better understanding of individual behavior to the extent that the evolution of certain characteristics of preferences and their consequences on human behavior forms the overarching theme of the dissertation. The long-term effect of evolutionary forces on a particular characteristic of importance in the theoretical, empirical and experimental economic literature, the concept of inequality aversion, is subject of the article “The evolution of inequality aversion in a simplified game of life” (Chapter 4). The contribution of the article is the overcoming of a restriction of former approaches to analyze the evolution of preferences in very simple environments. By classifying human interaction into three central economic games, the article provides a first step towards a simplified and sufficiently complete description of the interaction environment. Within such an environment the article characterizes the evolutionary stable preference distribution. One result shows, that the interaction of the aforementioned three classes can stabilize a preference of inequality aversion in the subpopulation which is favored in the problem of redistribution. The two remaining articles are concerned with social norms, which dissemination is determined by medium-run forces of cultural evolution. The article “The impact of market innovations on the evolution of social norms: the sustainability case.“ (Chapter 2) studies the interrelation between product innovations which are relevant from a sustainability perspective and an according social norm in consumption. This relation is based on a conformity bias in consumption and the attempt to avoid cognitive dissonances resulting from non-compliant consumption. Among others, it is shown that a conformity bias on the consumption side can lead to multiple equilibria on the side of norm adoption. The article “Evolution of cooperation in social dilemmas: signaling internalized norms.” (Chapter 3) studies the emergence of cooperation in social dilemmas based on the signaling of social norms. The article provides a potential explanation of cooperative behavior, which does not rely on the assumption of structured populations or on the unmotivated ability of social norms to restrict individual actions or strategy spaces. A comprehensive result of the single articles is the explanation of the phenomenon of partial norm adaption or dissemination of preferences. The plurality of the applied approaches with respect to the proximity to the rational choice approach and regarding the underlying evolutionary mechanics is a particular strength of the thesis. It shows the equality of these approaches in their potential to explain the phenomenon of cooperation in environments that provide material incentives for defective behavior. This also points to the need of a unified framework considering the biological and cultural coevolution of preference patterns.