945 resultados para S°, expressed as SO3


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The epitopes recognized by CD8+ cytotoxic T lymphocytes (CTL) are generated from cytosolic proteins by proteolytic processing. The nature of the influences exerted by the sequences flanking CTL epitopes on these processing events remains controversial. Here we show that each epitope within an artificial polyepitope protein containing nine minimal CD8+ CTL epitopes in sequence was processed and presented to appropriate CTL clones. Natural flanking sequences were thus not required to direct class I proteolytic processing. In addition, unnatural flanking sequences containing other CTL epitopes did not interfere with processing. The ability of every CTL epitope to be effectively processed from a protein containing only CTL epitopes is likely to find application in the construction of recombinant polyepitope CTL vaccines.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Glycoproteins expressing the Lutheran blood group antigens were isolated from human erythrocyte membranes and from human fetal liver. Amino acid sequence analyses allowed the design of redundant oligonucleotides that were used to generate a 459-bp, sequence-specific probe by PCR. A cDNA clone of 2400 bp was isolated from a human placental lambda gt 11 library and sequenced, and the deduced amino acid sequence was studied. The predicted mature protein is a type I membrane protein of 597 amino acids with five potential N-glycosylation sites. There are five disulfide-bonded, extracellular, immunoglobulin superfamily domains (two variable-region set and three constant-region set), a single hydrophobic, membrane-spanning domain, and a cytoplasmic domain of 59 residues. The overall structure is similar to that of the human tumor marker MUC 18 and the chicken neural adhesion molecule SC1. The extracellular domains and cytoplasmic domain contain consensus motifs for the binding of integrin and Src homology 3 domains, respectively, suggesting possible receptor and signal-transduction function. Immunostaining of human tissues demonstrated a wide distribution and provided evidence that the glycoprotein is under developmental control in liver and may also be regulated during differentiation in other tissues.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The T-cell antigen receptor zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. zeta chain can associate with certain protein tyrosine kinases and retains the capacity to transduce signals independently of the other receptor subunits. Thus, zeta chain could couple cell-surface-expressed T-cell antigen receptors to the intracellular signal-transduction apparatus by its association with various intracellular molecules in addition to tyrosine kinases. In the process of searching for zeta chain-associated molecules we observed that after lysis of resting T cells with Triton X-100, zeta chain is localized in the detergent-insoluble fraction, in addition to its presence in the detergent-soluble fraction. Treatment of T cells with cytochalasin B, an actin-depolymerizing agent, leads to the complete dissociation of zeta chain from the Triton-insoluble fraction, suggesting a linkage between zeta chain and the cytoskeletal matrix. We have also determined that cytoskeletal-associated zeta chain is expressed on the cell surface. Furthermore, a tyrosine-phosphorylated 16-kDa zeta chain was detected only in the Triton-insoluble cytoskeletal fraction of resting T cells. zeta chain also maintains its association with the cytoskeleton when expressed in COS cells, inferring that the cytoskeletal elements involved in this linkage may be ubiquitous. Finally, we have localized a 42-amino acid region in the intracytoplasmic domain of zeta chain, which is crucial for maximal interaction between zeta chain and the cytoskeleton. Anchorage of cell-surface-expressed zeta chain to the cytoskeleton in resting T cells may facilitate recycling of receptor complexes and/or allow the transduction of external stimuli into the cell.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Electrophysiological and neuroanatomical methods were used to determine the extent to which neonatal forelimb removal altered the organization of the cuneate nucleus and representations of the fore- and hindlimbs in the primary somatosensory cortex of adult rats. Neonatal forelimb removal resulted in invasion of the cuneate nucleus by sciatic nerve primary afferents and development of cuneothalamic projection neurons with split receptive fields that included both the hindlimb and forelimb stump. Mapping in the primary somatosensory cortex of the neonatally manipulated adult rats demonstrated abnormalities, but the major change observed in the cuneate nucleus was demonstrable at only a few (5%) cortical recording sites in the remaining stump representation and there were none at all in the hindlimb representation. These results suggest that lesion-induced brainstem reorganization may be functionally suppressed at either the thalamic or cortical level.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An immunological screening strategy was used to select microbial genes expressed only in the host. Differential screening of a Borrelia burgdorferi (the Lyme disease agent) expression library identified a gene (p21) encoding a 20.7-kDa antigen that reacted with antibodies in serum from actively infected mice but not serum from mice immunized with heat-killed B. burgdorferi. Selective expression of p21 in the infected host was confirmed by Northern blot analysis and RNA PCR. Further differential screening of the expression library identified at least five additional B. burgdorferi genes are selectively expressed in vivo. This screening method can be used to identify genes induced in vivo in a wide variety of pathogenic microorganisms for which a gene transfer system is not currently available.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Ly-6 locus encodes several cell surface proteins whose functions are unknown. Although it is hypothesized that these proteins may be receptors, there is no direct evidence that they bind a ligand. Herein we present evidence that Ly-6A.2, a Ly-6 protein expressed on T lymphocytes, binds a ligand expressed on normal thymocytes and splenic B and T cells. We find that transgenic thymocytes that overexpress Ly-6A.2 spontaneously aggregate in culture. This homotypic adhesion requires the overexpression of Ly-6A.2 because it is not observed in cultures of nontransgenic thymocytes. The aggregation of Ly-6A.2 transgenic thymocytes is inhibited by phosphatidylinositol-specific phospholipase C (which removes Ly-6A.2 and other glycosylphosphatidylinositol-anchored proteins from the membrane). Some anti-Ly-6A.2 monoclonal antibodies, including nonactivating ones and Fab' fragments, inhibit this aggregation. In contrast, other anti-Ly-6A.2 monoclonal antibodies increase the aggregation of transgenic but not nontransgenic thymocytes. To further examine whether Ly-6A.2 mediates adhesion (versus inducing another adhesion pathway) reaggregation assays were performed with paraformaldehyde-fixed Tg+ thymocytes. Paraformaldehyde-fixed Tg+ thymocytes reaggregate in culture and this aggregation is also blocked by phosphatidyl-inositol-specific phospholipase C and anti-Ly-6A.2 monoclonal antibodies. These results indicate that the homotypic adhesion of cultured Ly-6A.2 transgenic thymocytes is directly mediated by Ly-6A.2 and, more importantly, strongly suggests that Ly-6A.2 binds a ligand that is expressed on thymocytes. Tg+ thymocytes also bind to nontransgenic thymocytes, B cells, and T cells, indicating that normal cells naturally express the Ly-6A.2 ligand.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies have implicated the bcl-2 protooncogene as a potential regulator of neuronal survival. However, mice lacking functional bcl-2 exhibited normal development and maintenance of the central nervous system (CNS). Since bcl-2 appears dispensable for neuronal survival, we have examined the expression and function of bcl-x, another member of the bcl-2 family of death regulatory genes. Bcl-2 is expressed in neuronal tissues during embryonic development but is down-regulated in the adult CNS. In contrast, Bcl-xL expression is retained in neurons of the adult CNS. Two different forms of bcl-x mRNA and their corresponding products, Bcl-xL and Bcl-x beta, were expressed in embryonic and adult neurons of the CNS. Microinjection of bcl-xL and bcl-x beta cDNAs into primary sympathetic neurons inhibited their death induced by nerve growth factor withdrawal. Thus, Bcl-x proteins appear to play an important role in the regulation of neuronal survival in the adult CNS.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The utrophin gene is closely related to the dystrophin gene in both sequence and genomic structure. The Duchenne muscular dystrophy (DMD) locus encodes three 14-kb dystrophin transcripts in addition to several smaller isoforms, one of which, Dp116, is specific to peripheral nerve. We describe here the corresponding 5.5-kb mRNA from the utrophin locus. This transcript, designated G-utrophin, is of particular interest because it is specifically expressed in the adult mouse brain and appears to be the predominant utrophin transcript in this tissue. G-utrophin is expressed in brain sites generally different from the regions expressing beta-dystroglycan. During mouse embryogenesis G-utrophin is also seen in the developing sensory ganglia. Our data confirm the close evolutionary relationships between the DMD and utrophin loci; however, the functions for the corresponding proteins probably differ.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Low-copy repeats have been associated with genomic rearrangements and have been implicated in the generation of mutations in several diseases. Here we characterize a subset of low-copy repeats in the spinal muscular atrophy (SMA) region in human chromosome 5q13. We show that this repeated sequence, named c41-cad, is a highly expressed pseudogene derived from an intact neuronal cadherin gene, Br-cadherin, situated on 5p13-14. Br-cadherin is expressed specifically in the brain, whereas the c41-cad transcripts are 10-15 times more abundant and are present in all tissues examined. We speculate that the c41-cad repeats, separately or in concert with other repeats in the SMA region, are involved in the pathogenesis of SMA by promoting rearrangements and deletions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rhodopsin folding and assembly were investigated by expression of five bovine opsin gene fragments separated at points corresponding to proteolytic cleavage sites in the second or third cytoplasmic regions. The CH(1-146) and CH(147-348) gene fragments encode amino acids 1-146 and 147-348 of opsin, while the TH(1-240) and TH(241-348) gene fragments encode amino acids 1-240 and 241-348, respectively. Another gene fragment, CT(147-240), encodes amino acids 147-240. All five opsin polypeptide fragments were stably produced upon expression of the corresponding gene fragments in COS-1 cells. The singly expressed polypeptide fragments failed to form a chromophore with 11-cis-retinal, whereas coexpression of two or three complementary fragments [CH(1-146) + CH(147-348), TH(1-240) + TH(241-348), or CH(1-146) + CT(147-240) + TH(241-348)] formed pigments with spectral properties similar to wild-type rhodopsin. The NH2-terminal polypeptide in these rhodopsins showed a glycosylation pattern characteristic of wild-type COS-1 cell rhodopsin and was noncovalently associated with its complementary fragment(s). Further, the CH(1-146) + CH(147-348) rhodopsin showed substantial light-dependent activation of transducin. We conclude that the functional assembly of rhodopsin is mediated by the association of at least three protein-folding domains.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have cloned an additional member (GC-D) of the membrane receptor guanylyl cyclase [GTP pyrophosphate-lyase (cyclizing), EC 4.6.1.2] family that is specifically expressed in a subpopulation of olfactory sensory neurons. The extracellular, putative ligand-binding domain of the olfactory cyclase is similar in primary structure to two guanylyl cyclases expressed in the retina but diverges considerably from other known guanylyl cyclases. The expression of GC-D RNA is restricted to a small, randomly dispersed population of neurons that is within a single topographic zone in the olfactory neuroepithelium and resembles the pattern of the more diverse seven-transmembrane-domain odorant receptors. These observations suggest that GC-D may function directly in odor recognition or in modulating the sensitivity of a subpopulation of sensory neurons to specific odors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.