908 resultados para small-angle x-ray scattering
Resumo:
We present the result of polar angle resolved x¿ray photoemission spectroscopy on Al(111)/O and cluster calculations of the O(1s) binding energy (BE) for various model situations. In the experimental data two O(1s) peaks are observed, separated by 1.3 eV. The angular behavior (depth¿resolution) could indicate that the lower BE peak is associated with an O atom under the surface, and the higher BE peak with an O atom above the surface. Equally, it could indicate oxygen islands on the surface where the perimeter atoms have a higher O(1s) BE than the interior atoms. The cluster calculations show that the former interpretation cannot be correct, since an O ads below the surface has a higher calculated O(1s) BE than one above. Cluster calculations simulating oxygen islands are, however, consistent with the experimental data.
Resumo:
The most abundant clay mineral group in Iowa soils is montmorillonite, most commonly calcium-saturated (Hanway et al, 1960). The calcium montmorillonite-water system was therefore selected for detailed X-ray study. Montmorillonite is unusual among minerals in that it has an expanding lattice in the c direction. That is, upon wetting with water, the individual silicate layers separate to allow entry of water, and the mineral expands. Characteristics of this expansion are readily studied by means of X-ray diffraction: the X-ray diffraction angle gives the average layer-to-layer "d001" spacing for any given moisture condition; the sharpness of the diffraction peak is a measure of uniformity of the d001 spacing; and the intensity of the peak relates to uniformity of the d001 spacing and in addition to the electron density distribution within the repeating elements. The latter is embodied in the "structure factor".
Resumo:
Although the radiation doses involved in basic research radiology are relatively small, the increasing number of radiological procedures makes risks becoming increasingly high. Quality control techniques in radiological practice have to ensure an adequate system of protection for people exposed to radiation. These techniques belong to a quality assurance program for X-ray machines and are designed to correct problems related to equipment and radiological practices, to obtain radiological images of high quality and to reduce the unnecessary exposures.
Resumo:
The product of catalytic activity of the enzyme phospholipase A2, which resembles the core unit of animal toxins, on phospholipids is a 1:1 mixture of lysolipid and fatty acid. This mixture was studied by time-resolved simultaneous small- and wide angle x-ray diffraction over the temperature range from 23 to 53.5ºC. An unusually large lamellar structure was observed, with d = 11 nm, contradicting the complex functional dimer model between lysolipid and fatty acid. It can be explained by formation of a "double-bilayer", a new phase consisting of two different bilayers, one formed by lysophospholipid and other by fatty acid, bound together by head group interactions. Its strucutre was confirmed by simulations of the X-ray scattering pattern.
Resumo:
Effective processes to fractionate the main compounds in biomass, such as wood, are a prerequisite for an effective biorefinery. Water is environmentally friendly and widely used in industry, which makes it a potential solvent also for forest biomass. At elevated temperatures over 100 °C, water can readily hydrolyse and dissolve hemicelluloses from biomass. In this work, birch sawdust was extracted using pressurized hot water (PHWE) flow-through systems. The hypothesis of the work was that it is possible to obtain polymeric, water-soluble hemicelluloses from birch sawdust using flow-through PHW extractions at both laboratory and large scale. Different extraction temperatures in the range 140–200 °C were evaluated to see the effect of temperature to the xylan yield. The yields and extracted hemicelluloses were analysed to obtain sugar ratios, the amount of acetyl groups, furfurals and the xylan yields. Higher extraction temperatures increased the xylan yield, but decreased the molar mass of the dissolved xylan. As the extraction temperature increased, more acetic acid was released from the hemicelluloses, thus further decreasing the pH of the extract. There were only trace amounts of furfurals present after the extractions, indicating that the treatment was mild enough not to degrade the sugars further. The sawdust extraction density was increased by packing more sawdust in the laboratory scale extraction vessel. The aim was to obtain extracts with higher concentration than in typical extraction densities. The extraction times and water flow rates were kept constant during these extractions. The higher sawdust packing degree decreased the water use in the extractions and the extracts had higher hemicellulose concentrations than extractions with lower sawdust degrees of packing. The molar masses of the hemicelluloses were similar in higher packing degrees and in the degrees of packing that were used in typical PHWE flow-through extractions. The structure of extracted sawdust was investigated using small angle-(SAXS) and wide angle (WAXS) x-ray scattering. The cell wall topography of birch sawdust and extracted sawdust was compared using x-ray tomography. The results showed that the structure of the cell walls of extracted birch sawdust was preserved but the cell walls were thinner after the extractions. Larger pores were opened inside the fibres and cellulose microfibrils were more tightly packed after the extraction. Acetate buffers were used to control the pH of the extracts during the extractions. The pH control prevented excessive xylan hydrolysis and increased the molar masses of the extracted xylans. The yields of buffered extractions were lower than for plain water extractions at 160–170 °C, but at 180 °C yields were similar to those from plain water and pH buffers. The pH can thus be controlled during extraction with acetate buffer to obtain xylan with higher molar mass than those obtainable using plain water. Birch sawdust was extracted both in the laboratory and pilot scale. The performance of the PHWE flow-through system was evaluated in the laboratory and the pilot scale using vessels with the same shape but different volumes, with the same relative water flow through the sawdust bed, and in the same extraction temperature. Pre-steaming improved the extraction efficiency and the water flow through the sawdust bed. The extracted birch sawdust and the extracted xylan were similar in both laboratory and pilot scale. The PHWE system was successfully scaled up by a factor of 6000 from the laboratory to pilot scale and extractions performed equally well in both scales. The results show that a flow-through system can be further scaled up and used to extract water-soluble xylans from birch sawdust. Extracted xylans can be concentrated, purified, and then used in e.g. films and barriers, or as building blocks for novel material applications.
Resumo:
The X-ray test is a precise, fast and non-destructive method to detect mechanical damage in seeds. In the present study, the efficiency of X-ray analysis in identifying the extent of mechanical damage in sweet corn seeds and its relationship with germination and vigor was evaluated. Hybrid 'SWB 551' (sh2) seeds with round (R) and flat (F) shapes were classified as large (L), medium (M1, M2 and M3) and small (S), using sieves with round and oblong screens. After artificial exposure to different levels of damage (0, 1, 3, 5 and 7 impacts), seeds were X-rayed (15 kV, 5 min) and submitted to germination (25 °C/5 days) and cold (10 °C/7 days) tests. Digital images of normal and abnormal seedlings and ungerminated seeds from germination and cold tests were jointly analyzed with the seed X-ray images. Results showed that damage affecting the embryonic axis resulted in abnormal seedlings or dead seeds in the germination and cold tests. The X-ray analysis is efficient for identifying mechanical damage in sweet corn seeds, allowing damage severity to be associated with losses in germination and vigor.
Resumo:
A method is presented for determining the composition of thin films containing the elements Bi, Sr, Br, Cu, and Ca. Quantitative x-ray fluorescence (XRF) consisting of radioactive sources (secondary foil excitor 241Am-Mo source and 55Pe source), a Si(Li) detector, and a multichannel analyzer were employed. The XRF system was calibrated by using sol gel thin films of known element composition and also by sputtered thin films analyzed by the conventional Rutherford Back Scattering (RBS). The XRF system has been used to assist and optimize the sputter target composition required to produce high-Tc BiSrCaCuO films with the desired metal composition.
Resumo:
The interfilament spacing of the anterior byssus retractor muscle from Mytilus edulis was studied as the muscle was extended. It was found that variations in this spacing were very small and consistent with the hypothesis that the interfilament spacing was independent of the extension of the muscle. It was observed that the interfilament spacing was dependent on the osmolarity of the bathing medium. In concentrated solutions of the artificial seawater, the interfilament spacing decreased; while in dilute solutions of artificial seawater, it was observed that the interfilament spacing was increasing. X-ray diffraction patterns were obtained from fresh, and glutaraldehyde fixed, specimens of insect flight muscle from Sarcophaga bullata. There patterns were in general agreement with previous X-ray diffraction studies of insect flight muscle. A reflexion G at 93A was observed and interpreted as arising from diffraction in the mitochondria. Specimens of dried insect flight muscle produced a diffraction pattern consisting of arc and ring reflexions. This was interpreted as suggesting an ordered arrangement of cristae, in the mitochondria from these muscles.
Resumo:
Energies of muonic X-rays of the K-series of carbon, nitrogen and oxygen have been measured with an accuracy of about 15 eV. Root mean square radii of the nuclear charge distributions were deduced. The results 2.49±0.05 fm for carbon, 2.55 ±0.03 fm for nitrogen and 2.71 ±0.02 fm for oxygen are in good agreement at comparable accuracy with recent electron scattering data.
Resumo:
This paper highlights the key role played by solubility in influencing gelation and demonstrates that many facets of the gelation process depend on this vital parameter. In particular, we relate thermal stability (T-gel) and minimum gelation concentration (MGC) values of small-molecule gelation in terms of the solubility and cooperative self-assembly of gelator building blocks. By employing a van't Hoff analysis of solubility data, determined from simple NMR measurements, we are able to generate T-calc values that reflect the calculated temperature for complete solubilization of the networked gelator. The concentration dependence of T-calc allows the previously difficult to rationalize "plateau-region" thermal stability values to be elucidated in terms of gelator molecular design. This is demonstrated for a family of four gelators with lysine units attached to each end of an aliphatic diamine, with different peripheral groups (Z or Bee) in different locations on the periphery of the molecule. By tuning the peripheral protecting groups of the gelators, the solubility of the system is modified, which in turn controls the saturation point of the system and hence controls the concentration at which network formation takes place. We report that the critical concentration (C-crit) of gelator incorporated into the solid-phase sample-spanning network within the gel is invariant of gelator structural design. However, because some systems have higher solubilities, they are less effective gelators and require the application of higher total concentrations to achieve gelation, hence shedding light on the role of the MGC parameter in gelation. Furthermore, gelator structural design also modulates the level of cooperative self-assembly through solubility effects, as determined by applying a cooperative binding model to NMR data. Finally, the effect of gelator chemical design on the spatial organization of the networked gelator was probed by small-angle neutron and X-ray scattering (SANS/SAXS) on the native gel, and a tentative self-assembly model was proposed.
Resumo:
Acridine-4-carboxamides form a class of known DNA mono-intercalating agents that exhibit cytotoxic activity against tumour cell lines due to their ability to inhibit topoisomerases. Previous studies of bis-acridine derivatives have yielded equivocal results regarding the minimum length of linker necessary between the two acridine chromophores to allow bis-intercalation of duplex DNA. We report here the 1.7 angstrom resolution X-ray crystal structure of a six-carbon-linked bis(acridine-4-carboxamide) ligand bound to d(CGTACG)(2) molecules by non-covalent duplex cross-linking. The asymmetric unit consists of one DNA duplex containing an intercalated acridine-4-carboxamide chromophore at each of the two CG steps. The other half of each ligand is bound to another DNA molecule in a symmetry-related manner, with the alkyl linker threading through the minor grooves. The two crystallographically independent ligand molecules adopt distinct side chain interactions, forming hydrogen bonds to either O6 or N7 on the major groove face of guanine, in contrast to the semi-disordered state of mono-intercalators bound to the same DNA molecule. The complex described here provides the first structural evidence for the non-covalent cross-linking of DNA by a small molecule ligand and suggests a possible explanation for the inconsistent behaviour of six-carbon linked bis-acridines in previous assays of DNA bis-intercalation.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
A form of three-dimensional X-ray imaging, called Object 3-D, is introduced, where the relevant subject material is represented as discrete ‘objects’. The surface of each such object is derived accurately from the projections of its outline, and of its other discontinuities, in about ten conventional X-ray views, distributed in solid angle. This technique is suitable for many applications, and permits dramatic savings in radiation exposure and in data acquisition and manipulation. It is well matched to user-friendly interactive displays.
Resumo:
[Et3NH]4[Mo8O26] reacted with MgCl2 giving the triethylammonum magnesium β-octamolybdate(VI) salt [Et3NH]2[Mg(H2O)6Mo8O26]·2H2O (3) and the triethylammonium hydronium β-octaamolybdate(VI) salt [Et3NH]3[(H3O)Mo8O26·2H2O (4), respectively. A small amount of [Et3NH]2[Mo6O269] was formed as a by-product. The salts 3 and 4 were characterized by X-ray crystallography. The [Mg(H2O)6Mo8O26]2− moiety in 3 is polymeric, with each octahedral [Mg(H2O)6]2+ ion sandwiched between two β[Mo8O26]4− ions, being hydrogen bonded to three terminal MOO oxygen atoms on one face of each β[Mo8O26]4− ion. The X-ray crystal structure of 4 corresponds to the reported previously. IR and conductivity data are given for 3 and 4.
Resumo:
The reaction of the fulvalene titanium(III) hydride [{Ti(η5-C5H5)(μ-H)}2(μ-η5-η5-C10H8)] (1) with chlorine leads to [{Ti(η5-C5H5)(μ-Cl)}2(μ-η5-η5-C10H8)] (3) and [{Ti(η5-C5H5)Cl2}2(μ-η5-η5-C10H8)] (4). The reaction of 3 with azobenzene, in wet toluene, gives [{Ti(η5-C5H5)Cl}2(μ-O)(μ-η5-η5-C10H8)] (5) and 1,2-diphenyl hydrazine. The alkylation of 4 and the analogous zirconium complex [{Zr(η5-C5H55)Cl2}2(μ-η5-η5-C10H8)] (2) with LiCH2SiMe3 or LiCH3 permits isolation of the tetraalkyl derivatives [{M(η5-C5H5)(CH2SiMe3)2}2(μ-η5-η5-C10H8)] (M Ti (6); Zr (8)) and [{Ti(η5-C5H5)(CH3)2}2(μ-η5-η5C10H8)] (7). All the new fulvalene compounds were characterized by IR, and 1H and 13C NMR spectroscope, and mass spectra and 5 by X-ray diffraction. The structure of 5 is very similar to that of the comparable TiIV compound [{Ti(η5-C5H5)2Cl}2(μ-O)] except for the smaller TiOTi angle (159.4° against 173.81°) and a significant deviation from linearity.