GENOME-WIDE PROFILING UNVEILS CRITICIAL FUNCTIONS OF p53 IN HUMAN EMBRYONIC STEM CELLS

Embryonic stem cells (ESCs) possess two unique characteristics: infinite self-renewal and the potential to differentiate into almost every cell type (pluripotency). Recently, global expression analyses of metastatic breast and lung cancers revealed an ESC-like expression program or signature, specifically for cancers that are mutant for p53 function. Surprisingly, although p53 is widely recognized as the guardian of the genome, due to its roles in cell cycle checkpoints, programmed cell death or senescence, relatively little is known about p53 functions in normal cells, especially in ESCs. My hypothesis is that p53 has specific transcription regulatory functions in human ESCs (hESCs) that a) oppose pluripotency and b) protect the stem cell genome in response to DNA damage and stress signaling. In mouse ESCs, these roles are believed to coincide, as p53 promotes differentiation in response to DNA damage, but this is unexplored in hESCs. To determine the biological roles of p53, specifically in hESCs, we mapped genome-wide chromatin interactions of p53 by chromatin immunoprecipitation and massively parallel tag sequencing (ChIP-Seq), and did so under three VIdifferent conditions of hESC status: pluripotency, differentiation-initiated and DNA-damage-induced. ChIP-Seq showed that p53 is enriched at distinct, induction-specific gene loci during each of these different conditions. Microarray gene expression analysis and functional annotation of the distinct p53-target genes revealed that p53 regulates specific genes encoding developmental regulators, which are expressed in differentiation-initiated but not DNA- damaged hESCs. We further discovered that, in response to differentiation signaling, p53 binds regions of chromatin that are repressed but also poised for rapid activation by core pluripotency factors OCT4 and NANOG in pluripotent hESCs. In response to DNA damage, genes associated with migration and motility are targeted by p53; whereas, the prime targets of p53 in control of cell death are conserved for p53 regulation in both differentiation and DNA damage. Our genome-wide profiling and bioinformatics analyses show that p53 occupies a special set of developmental regulatory genes during early differentiation of hESCs and functions in an induction-specific manner. In conclusion, our research unveiled previously unknown functions of p53 in ESC biology, which augments our understanding of one of the most deregulated proteins in human cancers.

TURNOVER RATE OF THE NEURONAL CONNEXIN CX36 IN HELA CELLS

Electrical synapses formed of the gap junction protein Cx36 show a great deal of functional plasticity, much dependent on changes in phosphorylation state of the connexin. However, gap junction turnover may also be important for regulating cell-cell communication, and turnover rates of Cx36 have not been studied. Connexins have relatively fast turnover rates, with short half-lives measured to be 1.5 to 3.5 hours in pulse-chase analyses of connexins (Cx26 and Cx43) in tissue culture cells and whole organs. We utilized HaloTag technology to study the turnover rate of Cx36 in transiently transfected HeLa cells. The HaloTag protein forms irreversible covalent bonds with chloroalkane ligands, allowing pulse-chase experiments to be performed very specifically. The HaloTag open reading frame was inserted into an internal site in the C-terminus of Cx36 designed not to disrupt the regulatory phosphorylation sites and not to block the C-terminal PDZ interaction motif. Functional properties of Cx36-Halo were assessed by Neurobiotin tracer coupling, live cell imaging, and immunostaining. For the pulse-chase study, transiently transfected HeLa cells were pulse labeled with Oregon Green (OG) HaloTag ligand and chase labeled at various times with tetramethylrhodamine (TMR) HaloTag ligand. Cx36-Halo formed large junctional plaques at sites of contact between transfected HeLa cells and was also contained in a large number of intracellular vesicles. The Cx36-Halo transfected HeLa cells supported Neurobiotin tracer coupling that was regulated by activation and inhibition of PKA in the same manner as wild-type Cx36 transfected cells. In the pulse-chase study, junctional protein labeled with the pulse ligand (OG) was gradually replaced by newly synthesized Cx36 labeled with the chase ligand (TMR). The half-life for turnover of protein in junctional plaques was 2.8 hours. Treatment of the pulse-labeled cells with Brefeldin A (BFA) prevented the addition of new connexins to junctional plaques, suggesting that the assembly of Cx36 into gap junctions involves the traditional ER-Golgi-TGN-plasma membrane pathway. In conclusion, Cx36-Halo is functional and has a turnover rate in HeLa cells similar to that of other connexins that have been studied. This turnover rate is likely too slow to contribute substantially to short-term changes in coupling of neurons driven by transmitters such as dopamine, which take minutes to achieve. However, turnover may contribute to longer-term changes in coupling.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

The effect of protein tyrosine phosphatase SHP1 on tumorigenicity of the MDA -MB231 breast cancer cells

SHP1 is a cytosolic protein tyrosine phosphatase that contains two SH2 domains. It is highly expressed in hematopoietic cells and expressed in normal epithelium at lower levels. While SHP1 in hematopoietic cells is thought to be a negative regulator of cellular signaling by associating with and dephosphorylating various receptors and their downstream effectors after they become activated, its precise function in epithelium remains to be understood. The potential involvement of SHP1 in human tumorigenesis has been hypothesized from the findings that SHP1 can interact with, dephosphorylate, and regulate the activity of several protein tyrosine kinases (PTKs) implicated in human cancer. These PTKs include epidermal growth factor receptor (EGFR) and Src. Such speculation is also supported by the report that SHP1 is overexpressed in human ovarian cancers. ^ Here we report, for the first time, that the levels of SHP1 expression and activity are altered in human breast cancer cells in comparison with normal breast epithelium. In particular, SHP1 expression is nearly lost in the breast cancer cell lines MDA-MB231 and MDA-MB435. After the re-introduction of SHP1 both in wild type (wt) and enzymatically inactive (dn) forms, into the MDA-MB231 cells, we observed no changes in cellular proliferation. However, the overexpression of wt SHP1 led to increased anchorage-independent growth in the MDA-MB231 cells. SHP1 phosphatase activity is essential for such an increase since the overexpression of dn SHP1 had no effect. Enhanced turnorigenicity in nude mice was also observed in the MDA-MB231 cells overexpressing wt SHP1, but not dn SHP1, suggesting the crucial function of SHP1 enzymatic activity in this process. Our observations in this study indicate that SHP1 promotes tumorigenesis by a mechanism or mechanisms apart from enchancing angiogenesis. In addition, we have found no evidence that the overexpression of SHP1 could affect metastatic potential in the MDA-MB231 cells. ^ In the MDA-MB231 cells stably transfected with either wt or dn SHP1 the peak level of EGFR tyrosine phosphorylation induced by EGF, as well as the sensitivity to EGF stimulation, was not altered. However, the overexpression of wt SHP1 led to a slight increase in the kinetics of EGFR dephosphorylation, whereas the overexpression of dn SHP1 led to slightly delayed kinetics of EGFR dephosphorylation. The overexpression of either the wt or dn SHP1 did not lead to any significant increase in Src kinase activity. ^ In NIH3T3 cells, the transient overexpression of SHP1 led to no significant changes in MAP kinase (ERK2) activation by EGF or Akt activation by PDGF. In 3T3H4 cells, the transient overexpression of SHP1 led to no significant changes in MAP kinase (ERK2) activation by heregulin. The transient overexpression of wt SHP1 in the MDA-MB231 cells caused an apparent increase, ranging from 10% to 20%, in the G0/G1 population of the cells with a corresponding decrease in the S phase population. ^ In order to understand the mechanisms by which SHP1 exerts its positive effect on the tumorigenic potential of the MDA-MB231 cells, we employed two-dimensional electrophoresis in an attempt to identify cellular protein(s) with significantly altered tyrosine phosphorylation level upon wt SHP1 overexpression. The overexpression of wt SHP1 but not dn SHP1, leads increased tyrosine phosphorylation of a protein with a molecular weight of approximately 40 kDa and a pI between 5.9 to 6.6. ^

Intrinsic oxidative stress in cancer cells: A biochemical basis for therapeutic selectivity using ROS -generating agents

A major goal of chemotherapy is to selectively kill cancer cells while minimizing toxicity to normal cells. Identifying biological differences between cancer and normal cells is essential in designing new strategies to improve therapeutic selectivity. Superoxide dismutases (SOD) are crucial antioxidant enzymes required for the elimination of superoxide (O2·− ), a free radical produced during normal cellular metabolism. Previous studies in our laboratory demonstrated that 2-methoxyestradiol (2-ME), an estradiol derivative, inhibits the function of SOD and selectively kills human leukemia cells without exhibiting significant cytotoxicity in normal lymphocytes. The present work was initiated to examine the biochemical basis for the selective anticancer activity of 2-ME. Investigations using two-parameter flow cytometric analyses and ROS scavengers established that O2·− is a primary and essential mediator of 2-ME-induced apoptosis in cancer cells. In addition, experiments using SOD overexpression vectors and SOD knockout cells found that SOD is a critical target of 2-ME. Importantly, the administration of 2-ME resulted in the selective accumulation of O 2·− and apoptosis in leukemia and ovarian cancer cells. The preferential activity of 2-ME was found to be due to increased intrinsic oxidative stress in these cancer cells versus their normal counterparts. This intrinsic oxidative stress was associated with the upregulation of the antioxidant enzymes SOD and catalase as a mechanism to cope with the increase in ROS. Furthermore, oxygen consumption experiments revealed that normal lymphocytes decrease their respiration rate in response to 2-ME-induced oxidative stress, while human leukemia cells seem to lack this regulatory mechanism. This leads to an uncontrolled production of O2·−, severe accumulation of ROS, and ultimately ROS-mediated apoptosis in leukemia cells treated with 2-ME. The biochemical differences between cancer and normal cells identified here provide a basis for the development of drug combination strategies using 2-ME with other ROS-generating agents to enhance anticancer activity. The effectiveness of such a combination strategy in killing cancer cells was demonstrated by the use of 2-ME with agents/modalities such as ionizing radiation and doxorubicin. Collectively, the data presented here strongly suggests that 2-ME may have important clinical implications for the selective killing of cancer cells. ^

Localization of ion-regulatory epithelia in embryos and hatchlings of two cephalopods

The tissue distribution and ontogeny of Na+/K+-ATPase has been examined as an indicator for ion-regulatory epithelia in whole animal sections of embryos and hatchlings of two cephalopod species: the squid Loligo vulgaris and the cuttlefish Sepia officinalis. This is the first report of the immunohistochemical localization of cephalopod Na+/K+-ATPase with the polyclonal antibody alpha (H-300) raised against the human alpha1-subunit of Na+/K+-ATPase. Na+/K+-ATPase immunoreactivity was observed in several tissues (gills, pancreatic appendages, nerves), exclusively located in baso-lateral membranes lining blood sinuses. Furthermore, large single cells in the gill of adult L. vulgaris specimens closely resembled Na+/K+-ATPase-rich cells described in fish. Immunohistochemical observations indicated that the amount and distribution of Na+/K+-ATPase in late cuttlefish embryos was similar to that found in juvenile and adult stages. The ion-regulatory epithelia (e.g., gills, excretory organs) of the squid embryos and paralarvae exhibited less differentiation than adults. Na+/K+-ATPase activities for whole animals were higher in hatchlings of S. officinalis (157.0 ± 32.4 µmol/g FM/h) than in those of L. vulgaris (31.8 ± 3.3 µmol/g FM/h). S. officinalis gills and pancreatic appendages achieved activities of 94.8 ± 18.5 and 421.8 ± 102.3 µmol ATP/g FM/h, respectively. High concentrations of Na+/K+-ATPase in late cephalopod embryos might be important in coping with the challenging abiotic conditions (low pH, high pCO2) that these organisms encounter inside their eggs. Our results also suggest a higher sensitivity of squid vs. cuttlefish embryos to environmental acid-base disturbances.

The p42 variant of ETS1 protein rescues defective Fas-induced apoptosis in colon carcinoma cells

ETS1 is a cellular homologue of the product of the viral ets oncogene of the E26 virus, and it functions as a tissue-specific transcription factor. It plays an important role in cell proliferation, differentiation, lymphoid cell development, transformation, angiogenesis, and apoptosis. ETS1 controls the expression of critical genes involved in these processes by binding to ets binding sites present in the transcriptional regulatory regions. The ETS1 gene generates two proteins, p51 and a spliced variant, p42, lacking exon VII. In this paper we show that p42-ETS1 expression bypasses the damaged Fas-induced apoptotic pathway in DLD1 colon carcinoma cells by up-regulating interleukin 1β-converting enzyme (ICE)/caspase-1 and causes these cancer cells to become susceptible to the effects of the normal apoptosis activation system. ICE/caspase-1 is a redundant system in many cells and tissues, and here we demonstrate that it is important in activating apoptosis in cells where the normal apoptosis pathway is blocked. Blocking ICE/caspase-1 activity by using specific inhibitors of this protease prevents the p42-ETS1-induced apoptosis from occurring, indicating that the induced ICE/caspase-1 enzyme is responsible for killing the cancer cells. p42-ETS1 activates a critical alternative apoptosis pathway in cancer cells that are resistant to normal immune attack, and thus it may be useful as an anticancer therapeutic.

The RIIβ regulatory subunit of protein kinase A binds to cAMP response element: An alternative cAMP signaling pathway

cAMP, through the activation of cAMP-dependent protein kinase (PKA), is involved in transcriptional regulation. In eukaryotic cells, cAMP is not considered to alter the binding affinity of CREB/ATF to cAMP-responsive element (CRE) but to induce serine phosphorylation and consequent increase in transcriptional activity. In contrast, in prokaryotic cells, cAMP enhances the DNA binding of the catabolite repressor protein to regulate the transcription of several operons. The structural similarity of the cAMP binding sites in catabolite repressor protein and regulatory subunit of PKA type II (RII) suggested the possibility of a similar role for RII in eukaryotic gene regulation. Herein we report that RIIβ subunit of PKA is a transcription factor capable of interacting physically and functionally with a CRE. In contrast to CREB/ATF, the binding of RIIβ to a CRE was enhanced by cAMP, and in addition, RIIβ exhibited transcriptional activity as a Gal4-RIIβ fusion protein. These experiments identify RIIβ as a component of an alternative pathway for regulation of CRE-directed transcription in eukaryotic cells.

Aberrant intracellular localization of Varicella-Zoster virus regulatory proteins during latency

Varicella-Zoster virus (VZV) is a herpesvirus that becomes latent in sensory neurons after primary infection (chickenpox) and subsequently may reactivate to cause zoster. The mechanism by which this virus maintains latency, and the factors involved, are poorly understood. Here we demonstrate, by immunohistochemical analysis of ganglia obtained at autopsy from seropositive patients without clinical symptoms of VZV infection that viral regulatory proteins are present in latently infected neurons. These proteins, which localize to the nucleus of cells during lytic infection, predominantly are detected in the cytoplasm of latently infected neurons. The restriction of regulatory proteins from the nucleus of latently infected neurons might interrupt the cascade of virus gene expression that leads to a productive infection. Our findings raise the possibility that VZV has developed a novel mechanism for maintenance of latency that contrasts with the transcriptional repression that is associated with latency of herpes simplex virus, the prototypic alpha herpesvirus.

Nedd4 mediates control of an epithelial Na+ channel in salivary duct cells by cytosolic Na+

Epithelial Na+ channels are expressed widely in absorptive epithelia such as the renal collecting duct and the colon and play a critical role in fluid and electrolyte homeostasis. Recent studies have shown that these channels interact via PY motifs in the C terminals of their α, β, and γ subunits with the WW domains of the ubiquitin-protein ligase Nedd4. Mutation or deletion of these PY motifs (as occurs, for example, in the heritable form of hypertension known as Liddle’s syndrome) leads to increased Na+ channel activity. Thus, binding of Nedd4 by the PY motifs would appear to be part of a physiological control system for down-regulation of Na+ channel activity. The nature of this control system is, however, unknown. In the present paper, we show that Nedd4 mediates the ubiquitin-dependent down-regulation of Na+ channel activity in response to increased intracellular Na+. We further show that Nedd4 operates downstream of Go in this feedback pathway. We find, however, that Nedd4 is not involved in the feedback control of Na+ channels by intracellular anions. Finally, we show that Nedd4 has no influence on Na+ channel activity when the Na+ and anion feedback systems are inactive. We conclude that Nedd4 normally mediates feedback control of epithelial Na+ channels by intracellular Na+, and we suggest that the increased Na+ channel activity observed in Liddle’s syndrome is attributable to the loss of this regulatory feedback system.

Monitoring protein–protein interactions in intact eukaryotic cells by β-galactosidase complementation

We present an approach for monitoring protein–protein interactions within intact eukaryotic cells, which should increase our understanding of the regulatory circuitry that controls the proliferation and differentiation of cells and how these processes go awry in disease states such as cancer. Chimeric proteins composed of proteins of interest fused to complementing β-galactosidase (β-gal) deletion mutants permit a novel analysis of protein complexes within cells. In this approach, the β-gal activity resulting from the forced interaction of nonfunctional weakly complementing β-gal peptides (Δα and Δω) serves as a measure of the extent of interaction of the non-β-gal portions of the chimeras. To test this application of lacZ intracistronic complementation, proteins that form a complex in the presence of rapamycin were used. These proteins, FRAP and FKBP12, were synthesized as fusion proteins with Δα and Δω, respectively. Enzymatic β-gal activity served to monitor the formation of the rapamycin-induced chimeric FRAP/FKBP12 protein complex in a time- and dose-dependent manner, as assessed by histochemical, biochemical, and fluorescence-activated cell sorting assays. This approach may prove to be a valuable adjunct to in vitro immunoprecipitation and crosslinking methods and in vivo yeast two-hybrid and fluorescence energy transfer systems. It may also allow a direct assessment of specific protein dimerization interactions in a biologically relevant context, localized in the cell compartments in which they occur, and in the milieu of competing proteins.

MLN64 contains a domain with homology to the steroidogenic acute regulatory protein (StAR) that stimulates steroidogenesis

MLN64 is a protein that is highly expressed in certain breast carcinomas. The C terminus of MLN64 shares significant homology with the steroidogenic acute regulatory protein (StAR), which plays a key role in steroid hormone biosynthesis by enhancing the intramitochondrial translocation of cholesterol to the cholesterol side-chain cleavage enzyme. We tested the ability of MLN64 to stimulate steroidogenesis by using COS-1 cells cotransfected with plasmids expressing the human cholesterol side-chain cleavage enzyme system and wild-type and mutant MLN64 proteins. Wild-type MLN64 increased pregnenolone secretion in this system 2-fold. The steroidogenic activity of MLN64 was found to reside in the C terminus of the protein, because constructs from which the C-terminal StAR homology domain was deleted had no steroidogenic activity. In contrast, removal of N-terminal sequences increased MLN64’s steroidogenesis-enhancing activity. MLN64 mRNA was found in many human tissues, including the placenta and brain, which synthesize steroid hormones but do not express StAR. Western blot analysis revealed the presence of lower molecular weight immunoreactive MLN64 species that contain the C-terminal sequences in human tissues. Homologs of both MLN64 and StAR were identified in Caenorhabditis elegans, indicating that the two proteins are ancient. Mutations that inactivate StAR were correlated with amino acid residues that are identical or similar among StAR and MLN64, indicating that conserved motifs are important for steroidogenic activity. We conclude that MLN64 stimulates steroidogenesis by virtue of its homology to StAR.

CCAAT/enhancer binding protein (C/EBP) sites are required for HIV-1 replication in primary macrophages but not CD4+ T cells

The importance of CCAAT/enhancer binding proteins (C/EBPs) and binding sites for HIV-1 replication in primary macrophages, T cell lines and primary CD4+ T cells was examined. When lines overexpressing the C/EBP dominant-negative protein LIP were infected with HIV-1, replication occurred in Jurkat T cells but not in U937 promonocytes, demonstrating a requirement for C/EBP activators by HIV-1 only in promonocytes. Primary macrophages did not support the replication of HIV-1 harboring mutant C/EBP binding sites in the long terminal repeat but Jurkat, H9 and primary CD4+ T cells supported replication of wild-type and mutant HIV-1 equally well. Thus the requirement for C/EBP sites is also confined to monocyte/macrophages. The requirement for C/EBP proteins and sites identifies the first uniquely macrophage-specific regulatory mechanism for HIV-1 replication.

A T cell receptor antagonist peptide induces T cells that mediate bystander suppression and prevent autoimmune encephalomyelitis induced with multiple myelin antigens

Experimental autoimmune encephalomyelitis (EAE) induced with myelin proteolipid protein (PLP) residues 139–151 (HSLGKWLGHPDKF) can be prevented by treatment with a T cell receptor (TCR) antagonist peptide (L144/R147) generated by substituting at the two principal TCR contact residues in the encephalitogenic peptide. The TCR antagonist peptide blocks activation of encephalitogenic Th1 helper cells in vitro, but the mechanisms by which the antagonist peptide blocks EAE in vivo are not clear. Immunization with L144/R147 did not inhibit generation of PLP-(139–151)-specific T cells in vivo. Furthermore, preimmunization with L144/R147 protected mice from EAE induced with the encephalitogenic peptides PLP-(178–191) and myelin oligodendrocyte protein (MOG) residues 92–106 and with mouse myelin basic protein (MBP). These data suggest that the L144/R147 peptide does not act as an antagonist in vivo but mediates bystander suppression, probably by the generation of regulatory T cells. To confirm this we generated T cell lines and clones from animals immunized with PLP-(139–151) plus L144/R147. T cells specific for L144/R147 peptide were crossreactive with the native PLP-(139–151) peptide, produced Th2/Th0 cytokines, and suppressed EAE upon adoptive transfer. These studies demonstrate that TCR antagonist peptides may have multiple biological effects in vivo. One of the principal mechanisms by which these peptides inhibit autoimmunity is by the induction of regulatory T cells, leading to bystander suppression of EAE. These results have important implications for the treatment of autoimmune diseases where there are autopathogenic responses to multiple antigens in the target organ.

A calcium responsive element that regulates expression of two calcium binding proteins in Purkinje cells

Calbindin D28 encodes a calcium binding protein that is expressed in the cerebellum exclusively in Purkinje cells. We have used biolistic transfection of organotypic slices of P12 cerebellum to identify a 40-bp element from the calbindin promoter that is necessary and sufficient for Purkinje cell specific expression in this transient in situ assay. This element (PCE1) is also present in the calmodulin II promoter, which regulates expression of a second Purkinje cell Ca2+ binding protein. Expression of high levels of exogenous calbindin or calretinin decreased transcription mediated by PCE1 in Purkinje cells 2.5- to 3-fold, whereas the presence of 1 μM ionomycin in the extracellular medium increased expression. These results demonstrate that PCE1 is a component of a cell-specific and Ca2+-sensitive transcriptional regulatory mechanism that may play a key role in setting the Ca2+ buffering capacity of Purkinje cells.