Regulation of myogenesis by growth signals -growth factors, oncogenes and protein kinases

Establishment of a myogenic phenotype involves antagonism between cell proliferation and differentiation. The recent identification of the MyoD family of muscle-specific transcription factors provides opportunities to dissect at the molecular level the mechanisms through which defined cell type-specific transcription factors respond to environmental cues and regulate differentiation programs. This project is aimed at elucidation of the molecular mechanism whereby growth factors repress myogenesis. Initial studies demonstrated that nuclear oncogenes such as c-fos, junB and c-jun are immediate early genes that respond to serum and TGF-$\beta$. Using the muscle creatine kinase (MCK) enhancer linked to the reporter gene CAT as a marker for differentiation, we showed that transcriptional function of myogenin can be disrupted in the presence of c-Fos, JunB and cjun. In contrast, JunD, which shares DNA-binding specificity with JunB and c-Jun but is expressed constitutively in muscle cells, failed to show the inhibition. The repression by Fos and Jun is targeted at KE-2 motif, the same sequence that mediates myogenin-dependent activation and muscle-specific transactivation. Deletion analysis indicated that the transactivation domain of c-Jun at the N-terminus is responsible for the repression. Considering that myogenin is a phosphoprotein and cAMP and TPA are able to regulate myogenesis, we examined whether constitutively active protein kinase C (PKC) and protein kinase A (PKA) could substitute for exogenous growth factors and prevent transcription activation by myogenin. Indeed, the basic region of myogenin is phosphorylated by PKC at a threonine that is conserved in all members of the MyoD family. Phosphorylation at this site attenuates DNA binding activity of myogenin. Protein kinase A can also phosphorylate myogenin in a region adjacent to the DNA binding domain. However, phosphorylation at this site is insufficient to abrogate myogenin's DNA binding capacity, suggesting that PKA and PKC may affect myogenin transcriptional activity through different mechanisms. These findings provide insight into the mechanisms through which growth factor signals negatively regulate the muscle differentiation program and contribute to an understanding of signal transducing pathways between the cell membrane and nucleus. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Inhibitor of cytochrome c messenger RNA -protein interaction in stimulated rat skeletal muscle

The purpose of this work was to examine the possible mechanisms for the regulation of cytochrome c gene expression in response to increased contractile activity in rat skeletal muscle. The working hypothesis was that increased contractile activity enhances cytochrome c gene expression through a cis-element. A 110% increase in cytochrome c mRNA concentration was observed in tibialis anterior (TA) muscle after 9 days of chronic stimulation. Similar difference (120%) exists between soleus (SO) muscle of higher contractile activity and white vastus lateralis (WV) muscle of lower contractile activity. These results suggest that the endogenous cytochrome c gene expression is regulated by contractile activity. Cytochrome c-reporter genes were injected into skeletal muscles to identify the cis-element that is responsible for the regulation. Although the data was inconclusive, part of it suggested the importance of the 3$\sp\prime$-untranslated region (3$\sp\prime$-UTR) in mediating the response to increased contractile activity.^ RNA gel mobility shift (GMSA) and ultraviolet (UV) cross-linking assays revealed specific RNA-protein interaction in a 50-nucleotide region of the 3$\sp\prime$-UTR in unstimulated TA muscle. Computer analysis predicted a stem-loop structure of 17 nucleotides, which provides a structural basis for RNA-protein interaction. These 17 nucleotides are 100% conserved among rat, mouse and human cytochrome c genes and their 13 pseudogenes, suggesting a functional role for this region. The RNA-protein interaction was significantly less in highly active SO muscle than in inactive WV muscle and was dramatically decreased in stimulated TA muscle due to a protein inhibitor(s) associated with ribosome. It is possible that cytochrome c mRNAs undergoing translation are subject to a compartmentalized regulatory influence.^ The conclusion from these results is that increases in contractile activity induce or activate a protein inhibitor(s) associated with ribosome in rat skeletal muscle. The inhibitor decreases RNA-protein interaction in the 3$\sp\prime$-UTR of cytochrome c mRNA, which may result in increased mRNA stability and/or translation. ^

Growth regulatory role of R -PTPmu in normal and neoplastic epithelial cells

Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^

Functional analysis of the Galpha protein, GNA -3, in the development of Neurospora crassa using biochemical and genetic studies

Extracellular signals regulate fungal development and, to sense and respond to these cues, fungi evolved signal transduction pathways similar to those in mammalian systems. In fungi, heterotrimeric G proteins, composed of α, β, and γ subunits, transduce many signals, such as pheromones and nutrients, intracellularly to alter adenylyl cyclase and MAPK cascades activity. ^ Previously, the Gα proteins GNA-1 and GNA-2 were characterized in regulating development in the fungus Neurospora crassa. R. A. Baasiri isolated a third Gα, gna-3, and P. S. Rowley generated Δgna-3 mutants. GNA-3 belongs to a fungal Gα family that regulates cAMP metabolism and virulence. The Δ gna-3 sexual cycle is defective in homozygous crosses, producing inviable spores. Δgna-3 mutants have reduced aerial hyphae formation and derepressed asexual sporulation (conidiation), causing accumulation of asexual spores (conidia). These defects are similar to an adenylyl cyclase mutant, cr-1; cAMP supplementation suppressed Δ gna-3 and cr-1. Inappropriate conidiation and expression of a conidiation gene, con-10, were higher in Δ gna-3 than cr-1 submerged cultures; peptone suppressed conidiation. Adenylyl cyclase activity and expression demonstrated that GNA-3 regulates enzyme levels. ^ A Δgna-1 cr-1 was analyzed with F. D. Ivey to differentiate GNA-1 roles in cAMP-dependent and -independent pathways. Δ gna-1 cr-1 defects were worse than cr-1 and refractory to cAMP, suggesting that GNA-1 is necessary for sensing extracellular CAMP. Submerged culture conidiation was highest in Δgna-1 cr-1, and only high cell density Δgna-1 cultures conidiated, which correlated with con-10 levels. Transcription of a putative heat shock cognate protein was highest in Δgna-1 cr-1. ^ Functional relationships between the three Gαs was analyzed by constructing Δgna-1 Δgna-2 Δ gna-3, Δgna-1 Δgna-3, and Δgna-2 Δgna-3 strains. Δ gna-2 Δgna-3 strains exhibited intensified Δ gna-3 phenotypes; Δgna-1 Δgna-2 Δgna-3 and Δgna-1 Δ gna-3 strains were identical to Δgna-1 cr-1 on plates and were non-responsive to cAMP. The highest levels of conidiation and con-10 were detected in submerged cultures of Δ gna-1 Δgna-2 Δgna-3 and Δgna-1 Δgna-3 mutants, which was partially suppressed by peptone supplementation. Stimulation of adenylyl cyclase is completely deficient in Δgna-1 Δ gna-2 Δgna-3 and Δgna-1 Δ gna-3 strains. Δgna-3 and Δ gna-1 Δgna-3 aerial hyphae and conidiation defects were suppressed by mutation of a PKA regulatory subunit. ^

Roles of p38 mitogen-activated protein kinase pathway in the regulation of SOX9 activity and chondrogenesis

Sox9 is a master transcription factor in chondrocyte differentiation. Several lines of evidence suggest that the p38 mitogen-activated protein kinase (MAPK) pathway is involved in chondrocyte differentiation. In the present study, we examined the roles of p38 in the regulation of SOX9 activity and chondrogenesis. ^ COS7 cells were transfected with a SOX9 expression vector and 4x48-p89, a luciferase construction harboring four tandem copies of a SOX9-dependent 48-bp enhancer in Col2a1. Coexpression of MKK6EE, a constitutively active mutant of MKK6, a MAPKK that specifically activates p38, further increased the activity of the SOX9-dependent 48-bp enhancer about 5-fold, and SOX9 protein levels were not increased under these conditions. This increase in enhancer activity was not observed in a mutant enhancer construct harboring mutations that abolish SOX9 binding. These data strongly suggested that activation of the p38 pathway results in increased activity of SOX9. In addition, the increase of the activity of the SOX9-dependent 48-bp enhancer by MKK6EE was also observed in primary chondrocytes, and this increase was abolished by coexpression of a p38 phosphatase, MKP5, and p38 specific inhibitors. Furthermore, treatment of primary chondrocytes with p38 inhibitors decreased the expression of Col2a1, a downstream target of Sox9, without affecting Sox9 RNA levels, further supporting the hypothesis that p38 plays a role in regulating Sox9 activity in chondrocytes. ^ To further study the role of the p38 MAPK pathway in chondrogenesis, we generated transgenic mice that express MKK6EE in chondrocytes under the control of the Col2a1 promoter/intron regulatory sequences. These mice showed a dwarf phenotype characterized by reduced chondrocyte proliferation and a delay in the formation of primary and secondary ossification centers. Histological analysis using in situ hybridization showed reduced expression of Indian hedgehog, PTH/PTHrP receptor, cyclin D1 and increased expression of p21. In addition, consistent with the notion that Sox9 activity was increased in these mice, transgenic mice that express MKK6EE in chondrocytes showed phenotypes similar to those of mice that overexpress SOX9 in chondrocytes. Therefore, our study provides in vivo evidence for the role of p38 in chondrocyte differentiation and suggests that Sox9 is a downstream target of the p38 MAPK pathway. ^

Function of GCIP (CCNDBP1), a helix -loop -helix leucine -zip protein, in cell differentiation and tumorigenesis

Cell growth and differentiation are complex and well-organized processes in which cells respond to stimuli from the environment by carrying out genetic programs. Transcription factors with helix-loop-helix (HLH) motif play critical roles in controlling the expression of genes involved in lineage commitment, cell fate determination, proliferation and tumorigenesis. This study has examined the roles of GCIP (CCNDBP1) in cell differentiation and tumorigenesis. GCIP is a recently identified HLH-leucine zipper protein without a basic region like the Id family of proteins. However, GCIP shares little sequence homology with the Id proteins and has domains with high acidic amino acids and leucine-rich regions following the HLH domain like c-Myc. Here we firstly demonstrate that GCIP is a transcription regulator related to muscle differentiation program. Overexpression of GCIP in C2C12 cells not only promotes myotube formation but also upregulates myogenic differentiation biomarkers, including MHC and myogenein. On the other hand, our finding also suggests that GCIP is a potential tumor suppressor related to cell cycle control. Expression of GCIP was significantly down-regulated in colon tumors as compared to normal colon tissues. Overexpression of GCIP in SW480 colon cancer cell line resulted in a significant inhibition on tumor cell colony formation on soft agar assays while silencing of GCIP expression by siRNA can promote cell proliferation and colony formation. In addition, results from transgenic mice specifically expressing GCIP in liver also support the idea that GCIP is involved in the early stage of hepatocarcinogenesis and decreased susceptibility to chemical hepatocarcinogenesis. ^

The p42 variant of ETS1 protein rescues defective Fas-induced apoptosis in colon carcinoma cells

ETS1 is a cellular homologue of the product of the viral ets oncogene of the E26 virus, and it functions as a tissue-specific transcription factor. It plays an important role in cell proliferation, differentiation, lymphoid cell development, transformation, angiogenesis, and apoptosis. ETS1 controls the expression of critical genes involved in these processes by binding to ets binding sites present in the transcriptional regulatory regions. The ETS1 gene generates two proteins, p51 and a spliced variant, p42, lacking exon VII. In this paper we show that p42-ETS1 expression bypasses the damaged Fas-induced apoptotic pathway in DLD1 colon carcinoma cells by up-regulating interleukin 1β-converting enzyme (ICE)/caspase-1 and causes these cancer cells to become susceptible to the effects of the normal apoptosis activation system. ICE/caspase-1 is a redundant system in many cells and tissues, and here we demonstrate that it is important in activating apoptosis in cells where the normal apoptosis pathway is blocked. Blocking ICE/caspase-1 activity by using specific inhibitors of this protease prevents the p42-ETS1-induced apoptosis from occurring, indicating that the induced ICE/caspase-1 enzyme is responsible for killing the cancer cells. p42-ETS1 activates a critical alternative apoptosis pathway in cancer cells that are resistant to normal immune attack, and thus it may be useful as an anticancer therapeutic.

Ectopic expression of prion protein (PrP) in T lymphocytes or hepatocytes of PrP knockout mice is insufficient to sustain prion replication

The cellular form of the Prion protein (PrPC) is necessary for prion replication in mice. To determine whether it is also sufficient, we expressed PrP under the control of various cell- or tissue-specific regulatory elements in PrP knockout mice. The interferon regulatory factor-1 promoter/Eμ enhancer led to high PrP levels in the spleen and low PrP levels in the brain. Following i.p. scrapie inoculation, high prion titers were found in the spleen but not in the brain at 2 weeks and 6 months, showing that the lymphoreticular system by itself is competent to replicate prions. PrP expression directed by the Lck promoter resulted in high PrP levels on T lymphocytes only but, surprisingly, did not allow prion replication in the thymus, spleen, or brain following i.p. inoculation. A third transgenic line, which expressed PrP in the liver under the control of the albumin promoter/enhancer—albeit at low levels—also failed to replicate prions. These results show that expression of PrP alone is not sufficient to sustain prion replication and suggest that additional components are needed.

Effect of mutating the regulatory phosphoserine and conserved threonine on the activity of the expressed catalytic domain of Acanthamoeba myosin I heavy chain kinase

Phosphorylation of Ser-627 is both necessary and sufficient for full activity of the expressed 35-kDa catalytic domain of myosin I heavy chain kinase (MIHCK). Ser-627 lies in the variable loop between highly conserved residues DFG and APE at a position at which a phosphorylated Ser/Thr also occurs in many other Ser/Thr protein kinases. The variable loop of MIHCK contains two other hydroxyamino acids: Thr-631, which is conserved in almost all Ser/Thr kinases, and Thr-632, which is not conserved. We determined the effects on the kinase activity of the expressed catalytic domain of mutating Ser-627, Thr-631, and Thr-632 individually to Ala, Asp, and Glu. The S627A mutant was substantially less active than wild type (wt), with a lower kcat and higher Km for both peptide substrate and ATP, but was more active than unphosphorylated wt. The S627D and S627E mutants were also less active than phosphorylated wt, i.e., acidic amino acids cannot substitute for phospho-Ser-627. The activity of the T631A mutant was as low as that of the S627A mutant, whereas the T632A mutant was as active as phosphorylated wt, indicating that highly conserved Thr-631, although not phosphorylated, is essential for catalytic activity. Asp and Glu substitutions for Thr-631 and Thr-632 were inhibitory to various degrees. Molecular modeling indicated that Thr-631 can hydrogen bond with conserved residue Asp-591 in the catalytic loop and that similar interactions are possible for other kinases whose activities also are regulated by phosphorylation in the variable loop. Thus, this conserved Thr residue may be essential for the activities of other Ser/Thr protein kinases as well as for the activity of MIHCK.

Impaired fetal T cell development and perinatal lethality in mice lacking the cAMP response element binding protein

CREB, the cAMP response element binding protein, is a key transcriptional regulator of a large number of genes containing a CRE consensus sequence in their upstream regulatory regions. Mice with a hypomorphic allele of CREB that leads to a loss of the CREBα and Δ isoforms and to an overexpression of the CREBβ isoform are viable. Herein we report the generation of CREB null mice, which have all functional isoforms (CREBα, β, and Δ) inactivated. In contrast to the CREBαΔ mice, CREB null mice are smaller than their littermates and die immediately after birth from respiratory distress. In brain, a strong reduction in the corpus callosum and the anterior commissures is observed. Furthermore, CREB null mice have an impaired fetal T cell development of the αβ lineage, which is not affected in CREBαΔ mice on embryonic day 18.5. Overall thymic cellularity in CREB null mice is severely reduced affecting all developmental stages of the αβ T cell lineage. In contrast γδ T cell differentiation is normal in CREB mutant mice.

T cell vaccination induces T cell receptor Vβ-specific Qa-1-restricted regulatory CD8+ T cells

Vaccination of mice with activated autoantigen-reactive CD4+ T cells (T cell vaccination, TCV) has been shown to induce protection from the subsequent induction of a variety of experimental autoimmune diseases, including experimental allergic encephalomyelitis (EAE). Although the mechanisms involved in TCV-mediated protection are not completely known, there is some evidence that TCV induces CD8+ regulatory T cells that are specific for pathogenic CD4+ T cells. Previously, we demonstrated that, after superantigen administration in vivo, CD8+ T cells emerge that preferentially lyse and regulate activated autologous CD4+ T cells in a T cell receptor (TCR) Vβ-specific manner. This TCR Vβ-specific regulation is not observed in β2-microglobulin-deficient mice and is inhibited, in vitro, by antibody to Qa-1. We now show that similar Vβ8-specific Qa-1-restricted CD8+ T cells are also induced by TCV with activated CD4+ Vβ8+ T cells. These CD8+ T cells specifically lyse murine or human transfectants coexpressing Qa-1 and murine TCR Vβ8. Further, CD8+ T cell hybridoma clones generated from B10.PL mice vaccinated with a myelin basic protein-specific CD4+Vβ8+ T cell clone specifically recognize other CD4+ T cells and T cell tumors that express Vβ8 and the syngeneic Qa-1a but not the allogeneic Qa-1b molecule. Thus, Vβ-specific Qa-1-restricted CD8+ T cells are induced by activated CD4+ T cells. We suggest that these CD8+ T cells may function to specifically regulate activated CD4+ T cells during immune responses.

Unique regulatory properties of the type 2a Ca2+ channel β subunit caused by palmitoylation

β subunits of voltage-gated Ca2+ channels are encoded in four genes and display additional molecular diversity because of alternative splicing. At the functional level, all forms are very similar except for β2a, which differs in that it does not support prepulse facilitation of α1C Ca2+ channels, inhibits voltage-induced inactivation of neuronal α1E Ca2+ channels, and is more effective in blocking inhibition of α1E channels by G protein-coupled receptors. We show that the distinguishing properties of β2a, rather than interaction with a distinct site of α1, are because of the recently described palmitoylation of cysteines in positions three and four, which also occurs in the Xenopus oocyte. Essentially, all of the distinguishing features of β2a were lost in a mutant that could not be palmitoylated [β2a(Cys3,4Ser)]. Because protein palmitoylation is a dynamic process, these findings point to the possibility that regulation of palmitoylation may contribute to activity-dependent neuronal and synaptic plasticity. Evidence is presented that there may exist as many as three β2 splice variants differing only in their N-termini.

Structure of the Ets-1 pointed domain and mitogen-activated protein kinase phosphorylation site

The Pointed (PNT) domain and an adjacent mitogen-activated protein (MAP) kinase phosphorylation site are defined by sequence conservation among a subset of ets transcription factors and are implicated in two regulatory strategies, protein interactions and posttranslational modifications, respectively. By using NMR, we have determined the structure of a 110-residue fragment of murine Ets-1 that includes the PNT domain and MAP kinase site. The Ets-1 PNT domain forms a monomeric five-helix bundle. The architecture is distinct from that of any known DNA- or protein-binding module, including the helix-loop-helix fold proposed for the PNT domain of the ets protein TEL. The MAP kinase site is in a highly flexible region of both the unphosphorylated and phosphorylated forms of the Ets-1 fragment. Phosphorylation alters neither the structure nor monomeric state of the PNT domain. These results suggest that the Ets-1 PNT domain functions in heterotypic protein interactions and support the possibility that target recognition is coupled to structuring of the MAP kinase site.

Delayed embryonic lethality in mice lacking protein phosphatase 2A catalytic subunit Cα

Protein phosphatase 2A (PP2A) is a multimeric enzyme, containing a catalytic subunit complexed with two regulatory subunits. The catalytic subunit PP2A C is encoded by two distinct and unlinked genes, termed Cα and Cβ. The specific function of these two catalytic subunits is unknown. To address the possible redundancy between PP2A and related phosphatases as well as between Cα and Cβ, the Cα subunit gene was deleted by homologous recombination. Homozygous null mutant mice are embryonically lethal, demonstrating that the Cα subunit gene is an essential gene. As PP2A exerts a range of cellular functions including cell cycle regulation and cell fate determination, we were surprised to find that these embryos develop normally until postimplantation, around embryonic day 5.5/6.0. While no Cα protein is expressed, we find comparable expression levels of PP2A C at a time when the embryo is degenerating. Despite a 97% amino acid identity, Cβ cannot completely compensate for the absence of Cα. Degenerated embryos can be recovered even at embryonic day 13.5, indicating that although embryonic tissue is still capable of proliferating, normal differentiation is significantly impaired. While the primary germ layers ectoderm and endoderm are formed, mesoderm is not formed in degenerating embryos.