916 resultados para Test, Black-box testing
Resumo:
In response to the mandate on Load and Resistance Factor Design (LRFD) implementations by the Federal Highway Administration (FHWA) on all new bridge projects initiated after October 1, 2007, the Iowa Highway Research Board (IHRB) sponsored these research projects to develop regional LRFD recommendations. The LRFD development was performed using the Iowa Department of Transportation (DOT) Pile Load Test database (PILOT). To increase the data points for LRFD development, develop LRFD recommendations for dynamic methods, and validate the results ofLRFD calibration, 10 full-scale field tests on the most commonly used steel H-piles (e.g., HP 10 x 42) were conducted throughout Iowa. Detailed in situ soil investigations were carried out, push-in pressure cells were installed, and laboratory soil tests were performed. Pile responses during driving, at the end of driving (EOD), and at re-strikes were monitored using the Pile Driving Analyzer (PDA), following with the CAse Pile Wave Analysis Program (CAPWAP) analysis. The hammer blow counts were recorded for Wave Equation Analysis Program (WEAP) and dynamic formulas. Static load tests (SLTs) were performed and the pile capacities were determined based on the Davisson’s criteria. The extensive experimental research studies generated important data for analytical and computational investigations. The SLT measured loaddisplacements were compared with the simulated results obtained using a model of the TZPILE program and using the modified borehole shear test method. Two analytical pile setup quantification methods, in terms of soil properties, were developed and validated. A new calibration procedure was developed to incorporate pile setup into LRFD.
Resumo:
In this paper we deal with the identification of dependencies between time series of equity returns. Marginal distribution functions are assumed to be known, and a bivariate chi-square test of fit is applied in a fully parametric copula approach. Several families of copulas are fitted and compared with Spanish stock market data. The results show that the t-copula generally outperforms other dependence structures, and highlight the difficulty in adjusting a significant number of bivariate data series
Resumo:
Drilled shafts have been used in the US for more than 100 years in bridges and buildings as a deep foundation alternative. For many of these applications, the drilled shafts were designed using the Working Stress Design (WSD) approach. Even though WSD has been used successfully in the past, a move toward Load Resistance Factor Design (LRFD) for foundation applications began when the Federal Highway Administration (FHWA) issued a policy memorandum on June 28, 2000.The policy memorandum requires all new bridges initiated after October 1, 2007, to be designed according to the LRFD approach. This ensures compatibility between the superstructure and substructure designs, and provides a means of consistently incorporating sources of uncertainty into each load and resistance component. Regionally-calibrated LRFD resistance factors are permitted by the American Association of State Highway and Transportation Officials (AASHTO) to improve the economy and competitiveness of drilled shafts. To achieve this goal, a database for Drilled SHAft Foundation Testing (DSHAFT) has been developed. DSHAFT is aimed at assimilating high quality drilled shaft test data from Iowa and the surrounding regions, and identifying the need for further tests in suitable soil profiles. This report introduces DSHAFT and demonstrates its features and capabilities, such as an easy-to-use storage and sharing tool for providing access to key information (e.g., soil classification details and cross-hole sonic logging reports). DSHAFT embodies a model for effective, regional LRFD calibration procedures consistent with PIle LOad Test (PILOT) database, which contains driven pile load tests accumulated from the state of Iowa. PILOT is now available for broader use at the project website: http://srg.cce.iastate.edu/lrfd/. DSHAFT, available in electronic form at http://srg.cce.iastate.edu/dshaft/, is currently comprised of 32 separate load tests provided by Illinois, Iowa, Minnesota, Missouri and Nebraska state departments of transportation and/or department of roads. In addition to serving as a manual for DSHAFT and providing a summary of the available data, this report provides a preliminary analysis of the load test data from Iowa, and will open up opportunities for others to share their data through this quality–assured process, thereby providing a platform to improve LRFD approach to drilled shafts, especially in the Midwest region.
Resumo:
Understanding and anticipating biological invasions can focus either on traits that favour species invasiveness or on features of the receiving communities, habitats or landscapes that promote their invasibility. Here, we address invasibility at the regional scale, testing whether some habitats and landscapes are more invasible than others by fitting models that relate alien plant species richness to various environmental predictors. We use a multi-model information-theoretic approach to assess invasibility by modelling spatial and ecological patterns of alien invasion in landscape mosaics and testing competing hypotheses of environmental factors that may control invasibility. Because invasibility may be mediated by particular characteristics of invasiveness, we classified alien species according to their C-S-R plant strategies. We illustrate this approach with a set of 86 alien species in Northern Portugal. We first focus on predictors influencing species richness and expressing invasibility and then evaluate whether distinct plant strategies respond to the same or different groups of environmental predictors. We confirmed climate as a primary determinant of alien invasions and as a primary environmental gradient determining landscape invasibility. The effects of secondary gradients were detected only when the area was sub-sampled according to predictions based on the primary gradient. Then, multiple predictor types influenced patterns of alien species richness, with some types (landscape composition, topography and fire regime) prevailing over others. Alien species richness responded most strongly to extreme land management regimes, suggesting that intermediate disturbance induces biotic resistance by favouring native species richness. Land-use intensification facilitated alien invasion, whereas conservation areas hosted few invaders, highlighting the importance of ecosystem stability in preventing invasions. Plants with different strategies exhibited different responses to environmental gradients, particularly when the variations of the primary gradient were narrowed by sub-sampling. Such differential responses of plant strategies suggest using distinct control and eradication approaches for different areas and alien plant groups.
Resumo:
In the 1920s, Ronald Fisher developed the theory behind the p value and Jerzy Neyman and Egon Pearson developed the theory of hypothesis testing. These distinct theories have provided researchers important quantitative tools to confirm or refute their hypotheses. The p value is the probability to obtain an effect equal to or more extreme than the one observed presuming the null hypothesis of no effect is true; it gives researchers a measure of the strength of evidence against the null hypothesis. As commonly used, investigators will select a threshold p value below which they will reject the null hypothesis. The theory of hypothesis testing allows researchers to reject a null hypothesis in favor of an alternative hypothesis of some effect. As commonly used, investigators choose Type I error (rejecting the null hypothesis when it is true) and Type II error (accepting the null hypothesis when it is false) levels and determine some critical region. If the test statistic falls into that critical region, the null hypothesis is rejected in favor of the alternative hypothesis. Despite similarities between the two, the p value and the theory of hypothesis testing are different theories that often are misunderstood and confused, leading researchers to improper conclusions. Perhaps the most common misconception is to consider the p value as the probability that the null hypothesis is true rather than the probability of obtaining the difference observed, or one that is more extreme, considering the null is true. Another concern is the risk that an important proportion of statistically significant results are falsely significant. Researchers should have a minimum understanding of these two theories so that they are better able to plan, conduct, interpret, and report scientific experiments.
Resumo:
OBJECTIVES: The objective of this study was to evaluate associations between aortic pulse wave velocity (PWV) and aortic and carotid vessel wall thickness (VWT) using cardiovascular magnetic resonance imaging (MRI) in patients with hypertension as compared with healthy adult volunteers. MATERIALS AND METHODS: Local medical ethics approval was obtained and the participants gave informed consent. Fifteen patients with hypertension (5 men and 10 women; mean [SD] age, 49 [14] years) and 15 age- and sex-matched healthy volunteers were prospectively included and compared. All participants underwent MRI examination for measuring aortic and carotid VWT and aortic PWV with well-validated MRI techniques at 1.5- and 3-T MRI systems: PWV was assessed from velocity-encoded MRI and VWT was assessed by using dual-inversion black-blood gradient-echo imaging techniques. Paired t tests were used for testing differences between the volunteers and the patients and Pearson correlation (r) and univariable and multivariable stepwise linear regression analyses were used to test associations between aortic and carotid arterial wall thickness and stiffness. RESULTS: Mean values for aortic PWV and aortic and carotid VWT (indexed for body surface area [BSA]) were all significantly higher in patients with hypertension as compared with the healthy volunteers (ie, aortic PWV, 7.0 ± 1.4 m/s vs 5.7 ± 1.3 m/s; aortic VWT/BSA, 0.12 ± 0.03 mL/m vs 0.10 ± 0.03 mL/m; carotid VWT/BSA, 0.04 ± 0.01 mL/m vs 0.03 ± 0.01 mL/m; all P < 0.01). Aortic PWV was highly correlated with aortic VWT/BSA (r = 0.76 and P = 0.002 in the patients vs r = 0.63 and P = 0.02 in the volunteers), and in the patients, aortic PWV was moderately correlated with carotid VWT/BSA (r = 0.50; P = 0.04). In the volunteers, correlation between aortic PWV and carotid VWT/BSA was not significant (r = 0.40; P = 0.13). In addition, aortic VWT/BSA was significantly correlated with carotid VWT/BSA, in both the patients (r = 0.60; P = 0.005) and volunteers (r = 0.57; P = 0.007). CONCLUSIONS: In the patients with hypertension and the healthy volunteers, the aortic PWV is associated more strongly with aortic wall thickness than with carotid wall thickness, reflecting site-specific coupling between vascular wall thickness and function.
Resumo:
The objective of the investigation was the development of a test that would readily identify the potential of an aggregate to cause D-cracking because of its susceptivity to critical saturation. A Press-Ur-Meter was modified by replacing the air chamber with a one-inch diameter plastic tube calibrated in milli-. It was concluded that the pore index was sufficiently reliable to determine the D-cracking potential of limestone aggregates in all but a few cases where marginal results were obtained. Consistently poor or good results were always in agreement with established service records or concrete durability testing. In those instances where marginal results are obtained, the results of concrete durability testing should be considered when making the final determination of the D-cracking susceptibility of the aggregate in question. The following applications for the pore index test have been recommended for consideration: concrete durability testing be discontinued in the evaluation process of new aggregate sources with pore index results between 0-20 (Class 2 durability) and over 35 (Class 1) durability; composite aggregates with intermediate pore index results of 20-35 be tested on each stone type to facilitate the possible removal of low durability stone from the production process; and additional investigation should be made to evaluate the possibility of using the test to monitor and upgrade the acceptance of aggregate from sources associated with D-cracking.
Resumo:
Cardiovascular risk assessment might be improved with the addition of emerging, new tests derived from atherosclerosis imaging, laboratory tests or functional tests. This article reviews relative risk, odds ratios, receiver-operating curves, posttest risk calculations based on likelihood ratios, the net reclassification improvement and integrated discrimination. This serves to determine whether a new test has an added clinical value on top of conventional risk testing and how this can be verified statistically. Two clinically meaningful examples serve to illustrate novel approaches. This work serves as a review and basic work for the development of new guidelines on cardiovascular risk prediction, taking into account emerging tests, to be proposed by members of the 'Taskforce on Vascular Risk Prediction' under the auspices of the Working Group 'Swiss Atherosclerosis' of the Swiss Society of Cardiology in the future.
Resumo:
Culverts are common means to convey flow through the roadway system for small streams. In general, larger flows and road embankment heights entail the use of multibarrel culverts (a.k.a. multi-box) culverts. Box culverts are generally designed to handle events with a 50-year return period, and therefore convey considerably lower flows much of the time. While there are no issues with conveying high flows, many multi-box culverts in Iowa pose a significant problem related to sedimentation. The highly erosive Iowa soils can easily lead to the situation that some of the barrels can silt-in early after their construction, becoming partially filled with sediment in few years. Silting can reduce considerably the capacity of the culvert to handle larger flow events. Phase I of this Iowa Highway Research Board project (TR-545) led to an innovative solution for preventing sedimentation. The solution was comprehensively investigated through laboratory experiments and numerical modeling aimed at screening design alternatives and testing their hydraulic and sediment conveyance performance. Following this study phase, the Technical Advisory Committee suggested to implement the recommended sediment mitigation design to a field site. The site selected for implementation was a 3-box culvert crossing Willow Creek on IA Hwy 1W in Iowa City. The culvert was constructed in 1981 and the first cleanup was needed in 2000. Phase II of the TR 545 entailed the monitoring of the site with and without the selfcleaning sedimentation structure in place (similarly with the study conducted in laboratory). The first monitoring stage (Sept 2010 to December 2012) was aimed at providing a baseline for the operation of the as-designed culvert. In order to support Phase II research, a cleanup of the IA Hwy 1W culvert was conducted in September 2011. Subsequently, a monitoring program was initiated to document the sedimentation produced by individual and multiple storms propagating through the culvert. The first two years of monitoring showed inception of the sedimentation in the first spring following the cleanup. Sedimentation continued to increase throughout the monitoring program following the depositional patterns observed in the laboratory tests and those documented in the pre-cleaning surveys. The second part of Phase II of the study was aimed at monitoring the constructed self-cleaning structure. Since its construction in December 2012, the culvert site was continuously monitored through systematic observations. The evidence garnered in this phase of the study demonstrates the good performance of the self-cleaning structure in mitigating the sediment deposition at culverts. Besides their beneficial role in sediment mitigation, the designed self-cleaning structures maintain a clean and clear area upstream the culvert, keep a healthy flow through the central barrel offering hydraulic and aquatic habitat similar with that in the undisturbed stream reaches upstream and downstream the culvert. It can be concluded that the proposed self-cleaning structural solution “streamlines” the area upstream the culvert in a way that secures the safety of the culvert structure at high flows while producing much less disturbance in the stream behavior compared with the current constructive approaches.
Resumo:
OBJECTIVES: To obtain information about the prevalence of, reasons for, and adequacy of HIV testing in the general population in Switzerland in 1992. DESIGN: Telephone survey (n = 2800). RESULTS: Some 47% of the sample underwent one HIV test performed through blood donation (24%), voluntary testing (17%) or both (6%). Of the sample, 46% considered themselves well or very well informed about the HIV test. Patients reported unsystematic pre-test screening by doctors for the main HIV risks. People having been in situations of potential exposure to risk were more likely to have had the test than others. Overall, 85% of those HIV-tested had a relevant, generally risk-related reason for having it performed. CONCLUSIONS: HIV testing is widespread in Switzerland. Testing is mostly performed for relevant reasons. Pre-test counselling is poor and an opportunity for prevention is thus lost.
Resumo:
When researchers introduce a new test they have to demonstrate that it is valid, using unbiased designs and suitable statistical procedures. In this article we use Monte Carlo analyses to highlight how incorrect statistical procedures (i.e., stepwise regression, extreme scores analyses) or ignoring regression assumptions (e.g., heteroscedasticity) contribute to wrong validity estimates. Beyond these demonstrations, and as an example, we re-examined the results reported by Warwick, Nettelbeck, and Ward (2010) concerning the validity of the Ability Emotional Intelligence Measure (AEIM). Warwick et al. used the wrong statistical procedures to conclude that the AEIM was incrementally valid beyond intelligence and personality traits in predicting various outcomes. In our re-analysis, we found that the reliability-corrected multiple correlation of their measures with personality and intelligence was up to .69. Using robust statistical procedures and appropriate controls, we also found that the AEIM did not predict incremental variance in GPA, stress, loneliness, or well-being, demonstrating the importance for testing validity instead of looking for it.
Resumo:
The present work focuses the attention on the skew-symmetry index as a measure of social reciprocity. This index is based on the correspondence between the amount of behaviour that each individual addresses to its partners and what it receives from them in return. Although the skew-symmetry index enables researchers to describe social groups, statistical inferential tests are required. The main aim of the present study is to propose an overall statistical technique for testing symmetry in experimental conditions, calculating the skew-symmetry statistic (Φ) at group level. Sampling distributions for the skew- symmetry statistic have been estimated by means of a Monte Carlo simulation in order to allow researchers to make statistical decisions. Furthermore, this study will allow researchers to choose the optimal experimental conditions for carrying out their research, as the power of the statistical test has been estimated. This statistical test could be used in experimental social psychology studies in which researchers may control the group size and the number of interactions within dyads.
Resumo:
The objective of this research project was to service load test a representative sample of old reinforced concrete bridges (some of them historic and some of them scheduled for demolition) with the results being used to create a database so the performance of similar bridges could be predicted. The types of bridges tested included two reinforced concrete open spandrel arches, two reinforced concrete filled spandrel arches, one reinforced concrete slab bridge, and one two span reinforced concrete stringer bridge. The testing of each bridge consisted of applying a static load at various locations on the bridges and monitoring strains and deflections in critical members. The load was applied by means of a tandem axle dump truck with varying magnitudes of load. At each load increment, the truck was stopped at predetermined transverse and longitudinal locations and strain and deflection data were obtained. The strain data obtained were then evaluated in relation to the strain values predicted by traditional analytical procedures and a carrying capacity of the bridges was determined based on the experimental data. The response of a majority of the bridges tested was considerably lower than that predicted by analysis. Thus, the safe load carrying capacities of the bridges were greater than those predicted by the analytical models, and in a few cases, the load carrying capacities were found to be three or four times greater than calculated values. However, the test results of one bridge were lower than those predicted by analysis and thus resulted in the analytical rating being reduced. The results of the testing verified that traditional analytical methods, in most instances, are conservative and that the safe load carrying capacities of a majority of the reinforced concrete bridges are considerably greater than what one would determine on the basis of analytical analysis alone. In extrapolating the results obtained from diagnostic load tests to levels greater than those placed on the bridge during the load test, care must be taken to ensure safe bridge performance at the higher load levels. To extrapolate the load test results from the bridges tested in this investigation, the method developed by Lichtenstein in NCHRP Project 12-28(13)A was used.
Resumo:
The characterization and categorization of coarse aggregates for use in portland cement concrete (PCC) pavements is a highly refined process at the Iowa Department of Transportation. Over the past 10 to 15 years, much effort has been directed at pursuing direct testing schemes to supplement or replace existing physical testing schemes. Direct testing refers to the process of directly measuring the chemical and mineralogical properties of an aggregate and then attempting to correlate those measured properties to historical performance information (i.e., field service record). This is in contrast to indirect measurement techniques, which generally attempt to extrapolate the performance of laboratory test specimens to expected field performance. The purpose of this research project was to investigate and refine the use of direct testing methods, such as X-ray analysis techniques and thermal analysis techniques, to categorize carbonate aggregates for use in portland cement concrete. The results of this study indicated that the general testing methods that are currently used to obtain data for estimating service life tend to be very reliable and have good to excellent repeatability. Several changes in the current techniques were recommended to enhance the long-term reliability of the carbonate database. These changes can be summarized as follows: (a) Limits that are more stringent need to be set on the maximum particle size in the samples subjected to testing. This should help to improve the reliability of all three of the test methods studied during this project. (b) X-ray diffraction testing needs to be refined to incorporate the use of an internal standard. This will help to minimize the influence of sample positioning errors and it will also allow for the calculation of the concentration of the various minerals present in the samples. (c) Thermal analysis data needs to be corrected for moisture content and clay content prior to calculating the carbonate content of the sample.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.