952 resultados para Rubisco small subunit gene ( rbcS) Promoter
Resumo:
The cAMP-dependent protein kinase (PKA) has been shown to play an important role in long-term potentiation (LTP) in the hippocampus, but little is known about the function of PKA in long-term depression (LTD). We have combined pharmacologic and genetic approaches to demonstrate that PKA activity is required for both homosynaptic LTD and depotentiation and that a specific neuronal isoform of type I regulatory subunit (RI beta) is essential. Mice carrying a null mutation in the gene encoding RI beta were established by use of gene targeting in embryonic stem cells. Hippocampal slices from mutant mice show a severe deficit in LTD and depotentiation at the Schaffer collateral-CA1 synapse. This defect is also evident at the lateral perforant path-dentate granule cell synapse in RI beta mutant mice. Despite a compensatory increase in the related RI alpha protein and a lack of detectable changes in total PKA activity, the hippocampal function in these mice is not rescued, suggesting a unique role for RI beta. Since the late phase of CA1 LTP also requires PKA but is normal in RI beta mutant mice, our data further suggest that different forms of synaptic plasticity are likely to employ different combinations of regulatory and catalytic subunits.
Resumo:
The DNA-activated serine/threonine protein kinase (DNA-PK) is composed of a large (approximately 460 kDa) catalytic polypeptide (DNA-PKcs) and Ku, a heterodimeric DNA-binding component (p70/p80) that targets DNA-PKcs to DNA. A 41-kbp segment of the DNA-PKcs gene was isolated, and a 7902-bp segment was sequenced. The sequence contains a polymorphic Pvu II restriction enzyme site, and comparing the sequence with that of the cDNA revealed the positions of nine exons. The DNA-PKcs gene was mapped to band q11 of chromosome 8 by in situ hybridization. This location is coincident with that of XRCC7, the gene that complements the DNA double-strand break repair and V(D)J recombination defects (where V is variable, D is diversity, and J is joining) of hamster V3 and murine severe combined immunodeficient (scid) cells.
Resumo:
The cystic fibrosis transmembrane conductance regulator (CFTR) functions as a Cl- channel that becomes activated after phosphorylation by cAMP-dependent protein kinase (PKA). We demonstrate that PKA also plays a crucial role in maintaining basal expression of the CFTR gene in the human colon carcinoma cell line T84. Inhibition of PKA activity by expression of a dominant-negative regulatory subunit or treatment with the PKA-selective inhibitor N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide (H-89) caused a complete suppression of CFTR gene expression without affecting other constitutively active genes. Basal expression of a 2.2-kb region of the CFTR promoter linked to a luciferase reporter gene (CFTR-luc) exhibited the same dependence on PKA. The ability of cAMP to induce CFTR over basal levels is cell-type specific. In T84 cells, both the endogenous CFTR gene and CFTR-luc exhibited only a modest inducibility (approximately 2-fold), whereas in the human choriocarcinoma cell line JEG-3, CFTR-luc could be induced at least 4-fold. A variant cAMP-response element is present at position -48 to -41 in the CFTR promoter, and mutation of this sequence blocks basal expression. We conclude that cAMP, acting through PKA, is an essential regulator of basal CFTR gene expression and may mediate an induction of CFTR in responsive cell types.
Resumo:
The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.
Resumo:
We have identified a naturally occurring mutation in the promoter of the lipoprotein lipase (LPL) gene. One of 20 patients with familial combined hyperlipidemia (FCHL) and reduced levels of postheparin plasma LPL activity was found to be a heterozygote carrier of this mutation. The mutation, a T-->C substitution at nt -39, occurred in the binding site of the transcription factor Oct-1. As a result, the transcriptional activity of the mutant promoter was < 15% of wild type, as determined by transfection studies in the human macrophage-like cell line THP-1. This decrease in promoter activity was observed in undifferentiated as well as in phorbol ester-differentiated THP-1 cells. Furthermore, the inductive effect of elevating the levels of intracellular cAMP was equally reduced. This mutation was not present among 20 FCHL patients with normal plasma LPL levels nor has it been reported among individuals with familial LPL deficiency. Thus, heterozygosity for LPL promoter mutations may be one of several factors that contribute to the etiology of FCHL.
Resumo:
In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as superoxide dismutase (SOD) and catalase. Here we describe the isolation and characterization of another gene in the yeast Saccharomyces cerevisiae that plays a critical role in detoxification of reactive oxygen species. This gene, named ATX1, was originally isolated by its ability to suppress oxygen toxicity in yeast lacking SOD. ATX1 encodes a 8.2-kDa polypeptide exhibiting significant similarity and identity to various bacterial metal transporters. Potential ATX1 homologues were also identified in multicellular eukaryotes, including the plants Arabidopsis thaliana and Oryza sativa and the nematode Caenorhabditis elegans. In yeast cells, ATX1 evidently acts in the transport and/or partitioning of copper, and this role in copper homeostasis appears to be directly relevant to the ATX1 suppression of oxygen toxicity: ATX1 was incapable of compensating for SOD when cells were depleted of exogenous copper. Strains containing a deletion in the chromosomal ATX1 locus were generated. Loss of ATX1 function rendered both mutant and wild-type SOD strains hypersensitive toward paraquat (a generator of superoxide anion) and was also associated with an increased sensitivity toward hydrogen peroxide. Hence, ATX1 protects cells against the toxicity of both superoxide anion and hydrogen peroxide.
Resumo:
Mutations in the Saccharomyces cerevisiae SSU71 gene were isolated as suppressors of a transcription factor TFIIB defect that confers both a cold-sensitive growth defect and a downstream shift in transcription start-site selection at the cyc1 locus. The ssu71-1 suppressor not only suppresses the conditional phenotype but also restores the normal pattern of transcription initiation at cyc1. In addition, the ssu71-1 suppressor confers a heat-sensitive phenotype that is dependent upon the presence of the defective form of TFIIB. Molecular and genetic analysis of the cloned SSU71 gene demonstrated that SSU71 is a single-copy essential gene encoding a highly charged protein with a molecular mass of 82,194 daltons. Comparison of the deduced Ssu71 amino acid sequence with the protein data banks revealed significant similarity to RAP74, the larger subunit of the human general transcription factor TFIIF. Moreover, Ssu71 is identical to p105, a component of yeast TFIIF. Taken together, these data demonstrate a functional interaction between TFIIB and the large subunit of TFIIF and that this interaction can affect start-site selection in vivo.
Resumo:
Mutations in the gene encoding the beta subunit of rod cGMP phosphodiesterase are known causes of photoreceptor degeneration in two animal models of retinitis pigmentosa, the rd (retinal degeneration) mouse and the Irish setter dog with rod/cone dysplasia. Here we report a screen of 92 unrelated patients with autosomal recessive retinitis pigmentosa for defects in the human homologue of this gene. We identified seven different mutations that cosegregate with the disease. They were found among four patients with each patient heterozygously carrying two mutations. All of these mutations are predicted to affect the putative catalytic domain, probably leading to a decrease in phosphodiesterase activity and an increase in cGMP levels within rod photoreceptors. Mutations in the gene encoding the beta subunit of rod phosphodiesterase are the most common identified cause of autosomal recessive retinitis pigmentosa, accounting for approximately 4% of cases in North America.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Os microRNAs (miRNAs) são pequenos RNAs endógenos não codantes de 21-24 nucleotÃdeos (nt) que regulam a expressão gênica de genes-alvos. Eles estão envolvidos em diversos aspectos de desenvolvimento da planta, tanto na parte aérea, quanto no sistema radicular. Entre os miRNAs, o miRNA156 (miR156) regula a famÃlia de fatores de transcrição SQUAMOSA Promoter-Binding Protein-Like (SPL) afetando diferentes processos do desenvolvimento vegetal. Estudos recentes mostram que a via gênica miR156/SPL apresenta efeito positivo tanto no aumento da formação de raÃzes laterais, quanto no aumento de regeneração de brotos in vitro a partir de folhas e hipocótilos em Arabidopsis thaliana. Devido ao fato de que a origem da formação de raiz lateral e a regeneração in vitro de brotos a partir de raiz principal compartilham semelhanças anatômicas e moleculares, avaliou-se no presente estudo se a via miR156/SPL, da mesma forma que a partir de explantes aéreos, também é capaz de influenciar na regeneração de brotos in vitro a partir de explantes radiculares. Para tanto foram comparados taxa de regeneração, padrão de distribuição de auxina e citocinina, análises histológicas e histoquÃmicas das estruturas regeneradas em plantas com via miR156/SPL alterada, incluindo planta mutante hyl1, na qual a produção desse miRNA é severamente reduzida. Além disso, foi avaliado o padrão de expressão do miR156 e especÃficos genes SPL durante a regeneração de brotos in vitro a partir da raiz principal de Arabidopsis thaliana. No presente trabalho observou-se que a alteração da via gênica miR156/SPL é capaz de modular a capacidade de regeneração de brotos in vitro a partir de raiz principal de Arabidopsis thaliana e a distribuição de auxina e citocinina presente nas células e tecidos envolvidos no processo de regeneração. Plantas superexpressando o miR156 apresentaram redução no número de brotos regenerados, além de ter o plastochron reduzido quando comparado com plantas controle. Adicionalmente, plantas contento o gene SPL9 resistente à clivagem pelo miR156 (rSPL9) apresentaram severa redução na quantidade de brotos, além de terem o plastochron alongado. Interessantemente, plantas mutantes hyl1-2 e plantas rSPL10 não apresentaram regeneração de brotos ao longo da raiz principal, mas sim intensa formação de raÃzes laterais e protuberâncias, respectivamente, tendo essa última apresentado indÃcios de diferenciação celular precoce. Tomados em conjunto os dados sugerem que o miR156 apresenta importante papel no controle do processo de regeneração de brotos in vitro. Entretanto, esse efeito é mais complexo em regeneração in vitro a partir de raÃzes do que a partir de cotilédones ou hipocótilos.
Resumo:
Sulfate plays an essential role during growth, development, bone/cartilage formation, and cellular metabolism. In this study, we have isolated the human sulfate anion transporter cDNA (hsat-1; SCL26A1) and gene (SAT1), determined its protein function in Xenopus oocytes and characterized SAT1 promoter activity in mammalian renal cell lines. hsat-1 encodes a protein of 75 kDa, with 12 putative transmembrane domains, that induces sulfate, chloride, and oxalate transport in Xenopus oocytes. hsat-1 mRNA is expressed most abundantly in the kidney and liver, with lower levels in the pancreas, testis, brain, small intestine, colon, and lung. The SAT1 gene is comprised of four exons stretching 6 kb in length, with an alternative splice site formed from an optional exon. SAT1 5' flanking region led to promoter activity in renal OK and LLC-PK1 cells. Using SAT1 5' flanking region truncations, the first 135 bp was shown to be sufficient for basal promoter activity. Mutation of the activator protein-1 (AP-1) site at position 252 in the SAT1 promoter led to loss of transcriptional activity, suggesting its requirement for SAT1 basal expression. This study represents the first functional characterization of the human SAT1 gene and protein encoded by the anion transporter hsat-1.
Resumo:
The activity of the TRACP promoter has been investigated as a model of gene regulation in osteoclasts. The murine TRACP gene promoter contains potential binding sites for a number of transcription factors in particular, candidate sites for the Ets factor PU.1 and for the microphthalmia transcription factor (MiTF). These are of relevance to osteoclast biology because the PU.1 knockout mouse has an osteopetrotic phenotype, and MiTF, when mutated in the mi/mi mouse, also results in osteopetrosis. The binding sites for both of these factors have been identified, and they have been determined to be functional in regulating TRACP expression. A novel assay system using the highly osteoclastogenic RAW/C4 subclone of the murine macrophage cell line RAW264.7 was used to perform gene expression experiments on macrophage and osteoclast cell backgrounds. We have shown that TRACP expression is a target for regulation by the macrophage/osteoclast transcription factor PU.1 and the osteoclast commitment factor MiTF and that these factors act synergistically in regulating this promoter. This directly links two controlling factors of osteoclast differentiation to the expression of an effector of cell function.
Resumo:
Merkel cell carcinoma (MCC) is a rare aggressive skin tumor which shares histopathological and genetic features with small-cell lung carcinoma (SCLC), both are of neuroendocrine origin. Comparable to SCLC, MCC cell lines are classified into two different biochemical subgroups designated as 'Classic' and 'Variant'. With the aim to identify typical gene-expression signatures associated with these phenotypically different MCC cell lines subgroups and to search for differentially expressed genes between MCC and SCLC, we used cDNA arrays to pro. le 10 MCC cell lines and four SCLC cell lines. Using significance analysis of microarrays, we defined a set of 76 differentially expressed genes that allowed unequivocal identification of Classic and Variant MCC subgroups. We assume that the differential expression levels of some of these genes reflect, analogous to SCLC, the different biological and clinical properties of Classic and Variant MCC phenotypes. Therefore, they may serve as useful prognostic markers and potential targets for the development of new therapeutic interventions specific for each subgroup. Moreover, our analysis identified 17 powerful classifier genes capable of discriminating MCC from SCLC. Real-time quantitative RT-PCR analysis of these genes on 26 additional MCC and SCLC samples confirmed their diagnostic classification potential, opening opportunities for new investigations into these aggressive cancers.
Resumo:
The Mechanism Underlying the development of tolerance to morphine, is still incompletely understood. Morphine binds to opioid receptors, Which in turn activates downstream second messenger cascades through heterotrimeric guanine nucleotide binding proteins (G proteins). In this paper, we show that G(z), a member of the inhibitory G protein family, plays an important role in mediating the analgesic and lethality effects of morphine after tolerance development. We blocked signaling through the G(z) second messenger cascade by genetic ablation of the alpha subunit of the G protein in mice. The Galpha(z) knockout Mouse develops significantly increased tolerance to morphine. which depends oil Galpha(z), gene dosage. Further experiments demonstrate that the enhanced morphine tolerance is not caused by pharmacokinetic and behavioural learning mechanisms. The results suggest that G(z) signaling pathways are involved ill transducing the analgesic and lethality effects of morphine following chronic morphine treatment. (C) 2004 Elsevier Ltd. All rights reserved.