Forest Policy Scenario Analysis: Sensitivity of Songbird Community to Changes in Forest Cover Amount and Configuration

Changes in mature forest cover amount, composition, and configuration can be of significant consequence to wildlife populations. The response of wildlife to forest patterns is of concern to forest managers because it lies at the heart of such competing approaches to forest planning as aggregated vs. dispersed harvest block layouts. In this study, we developed a species assessment framework to evaluate the outcomes of forest management scenarios on biodiversity conservation objectives. Scenarios were assessed in the context of a broad range of forest structures and patterns that would be expected to occur under natural disturbance and succession processes. Spatial habitat models were used to predict the effects of varying degrees of mature forest cover amount, composition, and configuration on habitat occupancy for a set of 13 focal songbird species. We used a spatially explicit harvest scheduling program to model forest management options and simulate future forest conditions resulting from alternative forest management scenarios, and used a process-based fire-simulation model to simulate future forest conditions resulting from natural wildfire disturbance. Spatial pattern signatures were derived for both habitat occupancy and forest conditions, and these were placed in the context of the simulated range of natural variation. Strategic policy analyses were set in the context of current Ontario forest management policies. This included use of sequential time-restricted harvest blocks (created for Woodland caribou (Rangifer tarandus) conservation) and delayed harvest areas (created for American marten (Martes americana atrata) conservation). This approach increased the realism of the analysis, but reduced the generality of interpretations. We found that forest management options that create linear strips of old forest deviate the most from simulated natural patterns, and had the greatest negative effects on habitat occupancy, whereas policy options that specify deferment and timing of harvest for large blocks helped ensure the stable presence of an intact mature forest matrix over time. The management scenario that focused on maintaining compositional targets best supported biodiversity objectives by providing the composition patterns required by the 13 focal species, but this scenario may be improved by adding some broad-scale spatial objectives to better maintain large blocks of interior forest habitat through time.

GODIVA2: interactive visualization of environmental data on the Web

GODIVA2 is a dynamic website that provides visual access to several terabytes of physically distributed, four-dimensional environmental data. It allows users to explore large datasets interactively without the need to install new software or download and understand complex data. Through the use of open international standards, GODIVA2 maintains a high level of interoperability with third-party systems, allowing diverse datasets to be mutually compared. Scientists can use the system to search for features in large datasets and to diagnose the output from numerical simulations and data processing algorithms. Data providers around Europe have adopted GODIVA2 as an INSPIRE-compliant dynamic quick-view system for providing visual access to their data.

Mass and size distribution measurement of particulates from a gas turbine combustor using modern mobility analyzer and particle sizer

SMPS and DMS500 analysers were used to measure particulate size distributions in the exhaust of a fully annular aero gas turbine engine at two operating conditions to compare and analyse sources of discrepancy. A number of different dilution ratio values were utilised for the comparative analysis, and a Dekati hot diluter operating at a temperature of 623°K was also utilised to remove volatile PM prior to measurements being made. Additional work focused on observing the effect of varying the sample line temperatures to ascertain the impact. Explanations are offered for most of the trends observed, although a new, repeatable event identified in the range from 417°K to 423°K – where there was a three order of magnitude increase in the nucleation mode of the sample – requires further study.

"To strive for economic and social justice": welfare, sexuality, and party politics in San Francisco in the 1960s

This article explores how liberal politicians like Phil Burton of San Francisco joined with welfare rights lobbyists and bureaucrats to embrace late twntieth-century notions of sexual equality through a broader reconception of economic equality brought about by the expansion of the California welfare state in the early 1960s.

Tree Inscriptions: restoring a lost facet of the Graeco-Roman epigraphic habit

This article for the first time considers all extant ancient evidence for the habit of carving inscriptions on tree trunks. It emerges a picture that bears remarkable resemblances to what is known from the habit of graffiti writing (with important addition to that latter field to be derived from the findings), for individual and technical texts.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Short tandem repeat profiling provides an international reference standard for human cell lines

Cross-contamination between cell lines is a longstanding and frequent cause of scientific misrepresentation. Estimates from national testing services indicate that up to 36% of cell lines are of a different origin or species to that claimed. To test a standard method of cell line authentication, 253 human cell lines from banks and research institutes worldwide were analyzed by short tandem repeat profiling. The short tandem repeat profile is a simple numerical code that is reproducible between laboratories, is inexpensive, and can provide an international reference standard for every cell line. If DNA profiling of cell lines is accepted and demanded internationally, scientific misrepresentation because of cross-contamination can be largely eliminated.