Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Association Between Increased Platelet P-Selectin Expression and Obesity in Patients With Type 2 Diabetes A BARI 2D (Bypass Angioplasty Revascularization Investigation 2 Diabetes) substudy

OBJECTIVE- To determine whether obesity increases platelet reactivity and thrombin activity in patients with type 2 diabetes plus stable coronary artery disease. RESEARCH DESIGN AND METHODS- We assessed platelet reactivity and markers of thrombin generation and activity in 193 patients from nine clinical sites of the Bypass Angioplasty Revascularization Investigation 2 Diabetes (BARI 2D). Blood taken at the time of enrollment was used for assay of the concentration of prothrombin fragment 1.2 (PT1.2, released when prothrombin is activated) and fibrinopeptide A (FPA, released when fibrinogen is cleaved). Platelet activation was identified with the use of flow cytometry in response to 0, 0.2, and 1 mu mol/l adenosine diphosphate (ADP). RESULTS- Concentrations of FPA, PT1.2, and platelet activation in the absence of agonist were low. Greater BMI was associated with higher platelet reactivity in response to 1 mu m ADP as assessed by surface expression of P-selectin (r = 0.29, P < 0.0001) but not reflected by the binding of fibrinogen to activated glycoprotein IIb-IIIa. BMI was not associated with concentrations of FPA or PT1.2. Platelet reactivity correlated negatively with A1C (P < 0.04), was not related to the concentration Of triglycerides in blood, and did not correlate with the concentration of C-reactive peptide. CONCLUSIONS- Among patients enrolled in this substudy of BARI 2D, a greater BMI was associated with higher platelet reactivity at the time of enrollment. Our results suggest that obesity and insulin resistance that accompanies obesity may influence platelet reactivity in patients with type 2 diabetes.

Use of AST platelet ratio index (APRI Score) as an alternative to liver biopsy for treatment indication in chronic hepatitis C

Chronic hepatitis C (CHC) is one of the most important causes of chronic liver disease in the world, potentially resulting in cirrhosis, hepatocellular carcinoma, and the need for liver transplantation. Liver biopsy is currently performed before therapy indication. Although, it is the golden standard there are many reasons to avoid or delay the procedure. APRI Score is an easy, low cost and practice alternative method which was described as an alternative for assessing structural changes in chronic hepatitis C (CHC). The rationale of this study was to observe the accuracy of APRI Score in comparison to liver biopsy in 400 patients divided into two groups of 200 carriers (Validation and Experimental groups respectively) selected at random or according to liver fibrosis staging (METAVIR). The ROC curves showed a concordance among these two methods of 92% and 88.5% when 1.05 was the cut off (F3 and F4), and 87% and 83%, on 0.75 cut offs (F2-F4). The discordance in advanced fibrosis staging (F3 and F4) was only 16 (8%) and 22 (11%) out of 200 patients in the experimental and validation groups, respectively. In 26 (13%) out of 200 patients in the experimental group and 34 (17%) out of 200 patients in the validation group, there was discordance between APRI Score and liver biopsy in moderate and advanced fibrosis (F2-F4). In conclusion APRI is a serological marker that has satisfactory sensitivity and specificity together with a high predictive value and it can be useful either in the absence of a biopsy or to reduce the frequency with which biopsies need to be carried out to monitor the evolution of chronic hepatitis C and the right moment for treatment indication.

Metabolic syndrome features small, apolipoprotein A-I-poor, triglyceride-rich HDL3 particles with defective anti-apoptotic activity

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Elevated plasma membrane and sarcoplasmic reticulum Ca2+ pump mRNA levels in cultured aortic smooth muscle cells from spontaneously hypertensive rats

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Uptake by breast carcinoma of a lipidic nanoemulsion after intralesional injection into the patients: A new strategy for neoadjuvant chemotherapy

Objective. Previously we showed that after intravenous injection a lipidic nanoemulsion concentrates in breast carcinoma tissue and other solid tumors and may carry drugs directed against neoplastic tissues. Use of the nanoemulsion decreases toxicity of the chemotherapeutic agents without decreasing the anticancer action. Currently, the hypothesis was tested whether the nanoemulsion concentrates in breast carcinoma tissue after locoregional injection. Methods. Three different techniques of injection of the nanoemulsion were tested in patients scheduled for surgical treatment: G1 (n=4) into the mammary tissue 5 cm away from the tumor; G2 (n=4) into the peritumoral mammary tissue; G3 (n=6) into the tumoral tissue. The nanoemulsion labeled with radioactive cholesteryl oleate was injected 12 h before surgery; plasma decay of the label was determined from blood samples collected over 24 h and the tissue fragments excised during the surgery were analyzed for radioactivity uptake. Results. Among the three nanoemulsion injection techniques, G3 showed the greatest uptake (data expressed in c.p.m/g of tissue) by the tumor (44,769 +/- 54,749) and by the lymph node (2356 +/- 2966), as well as the greatest concentration in tumor compared to normal tissue (844 +/- 1673). In G1 and G2, uptakes were, respectively, tumor: 60 +/- 71 and 843 +/- 1526; lymph node: 263 +/- 375 and 102 +/- 74; normal tissue: 139 +/- 102 and 217 +/- 413. Conclusions. Therefore, with intralesional injection of the nanoemulsion, a great concentration effect can be achieved. This injection technique may be thus a promising approach for drug-targeting in neoadjuvant chemotherapy in breast cancer treatment. (C) 2008 Published by Elsevier Inc.

Development of a synthetic 7-ketocholesterol- rich emulsion resembling chylomicrons

Lipid emulsions that mimic natural lipoproteins help to understand the metabolism and the constitutional organization of circulating lipids. Chylomicrons synthesised by enterocyte cells usually contain oxysterols such as 7-ketocholesterol (7-KC). Here we describe the development of a 7-KC-containing emulsion as a model for oxisterol-rich chylomicron. Different amounts of 7-KC were used. Emulsion characteristics as effective diameter, lipid saturation with radiolabeled lipids was evaluated. In conclusion, the production of a synthetic 7-KC-rich emulsion resembling hylomicrons was feasible, being a model for in vivo metabolism studies.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Nitric oxide modulates lipopolysaccharide-induced endothelial platelet endothelial cell adhesion molecule expression via interleukin-10

We have shown previously that nitric oxide (NO) controls platelet endothelial cell adhesion molecule (PECAM-1) expression on both neutrophils and endothelial cells under physiological conditions. Here, the molecular mechanism by which NO regulates lipopolysaccharide (LPS)-induced endothelial PECAM-1 expression and the role of interleukin (IL)-10 on this control was investigated. For this purpose, N-(G)-nitro-L-arginine methyl ester (L-NAME; 20 mg/kg/day for 14 days dissolved in drinking water) was used to inhibit both constitutive (cNOS) and inducible nitric oxide (iNOS) synthase activities in LPS-stimulated Wistar rats (5 mg/kg, intraperitoneally). This treatment resulted in reduced levels of serum NO. Under this condition, circulating levels of IL-10 was enhanced, secreted mainly by circulating lymphocytes, dependent on transcriptional activation, and endothelial PECAM-1 expression was reduced independently on reduced gene synthesis. The connection between NO, IL-10 and PECAM-1 expression was examined by incubating LPS-stimulated (1 mu g/ml) cultured endothelial cells obtained from naive rats with supernatant of LPS-stimulated lymphocytes, which were obtained from blood of control or L-NAME-treated rats. Supernatant of LPS-stimulated lymphocytes obtained from L-NAME-treated rats, which contained higher levels of IL-10, reduced LPS-induced PECAM-1 expression by endothelial cells, and this reduction was reversed by adding the anti-IL-10 monoclonal antibody. Therefore, an association between NO, IL-10 and PECAM-1 was found and may represent a novel mechanism by which NO controls endothelial cell functions.

Synthetic nanoemulsion resembling a protein-free model of 7-ketocholesterol containing low density lipoprotein: In vitro and in vivo studies

7-ketocholesterol (7-KC) differs from cholesterol by a functional ketone group at C7. It is an oxygenated cholesterol derivative (oxysterol), commonly present in oxidized low-density lipoprotein (LDL). Oxysterols are generated and participate in several physiologic and pathophysiologic processes. For instance, the cytotoxic effects of oxidized LDL have been widely attributed to bioactive compounds like oxysterols. The toxicity is in part due to 7-KC. Here we aimed to demonstrate the possibility of incorporating 7-KC into the synthetic nanoemulsion LDE, which resembles LDL in composition and behavior. This would provide a suitable artificial particle resembling LDL to study 7-KC metabolism. We were able to incorporate 7-KC in several amounts into LDE. The incorporation was evaluated and confirmed by several methods, including gel filtration chromatography, using radiolabeled lipids. The incorporation did not change the main lipid composition characteristics of the new nanoparticle. Particle sizes were also evaluated and did not differ from LDE. In vivo studies were performed by injecting the nanoemulsion into mice. The plasma kinetics and the targeted organs were the same as described for LDE. Therefore, 7-KC-LDE maintains composition, size and some functional characteristics of LDE and could be used in experiments dealing with 7-ketocholesterol metabolism in lipoproteins.

Platelet protease-activated receptor 1 and membrane expression of P-selectin in pulmonary arterial hypertension

Introduction: Pulmonary arterial hypertension (PAH) is frequently associated with thrombotic events, particularly involving the pulmonary microcirculation at sites of vascular injury. We therefore decided to analyse protease-activated receptor 1 (PAR1), a key element in the activation of human platelets by thrombin, in PAH patients in stable clinical condition. Methods: Using flow cytometry, we analyzed platelet PAR1 density, PAR1-mediated exposure of P-selectin and the formation of platelet-leukocyte aggregates in 30 PAH patients aged 11 to 78 years (median 50.5 years). The control group consisted of 25 healthy subjects with the same age range as patients. Results: In patients, total platelet PAR1 density and uncleaved PAR1 density correlated negatively with platelet count (r(2) = 0.33 and r(2) = 0.34 respectively, p < 0.0015). In patients with a low platelet count (<150 x 10(9) platelets/L), both densities were increased relative to controls (82% and 33% respectively, p < 0.05). Thrombin peptide-induced platelet exposure of P-selectin was directly related to total and uncleaved PAR1 density (respectively, r(2) = 0.33 and r(2) = 0.29, p < 0.0025) and increased in subjects with low platelet count (46% versus those with normal platelet count, p < 0.05). Patients with low platelet count had decreased in vitro thrombin-induced formation of platelet-leukocyte aggregates (57% decrease versus controls, p < 0.05). Conclusions: There seems to be a subpopulation of PAH patients with increased propensity to thrombotic events as suggested by increased platelet PAR1 expression and PAR-mediated surface exposure of P-selectin associated with decreased platelet count. (C) 2009 Elsevier Ltd. All rights reserved.

The relationship between plasma potassium concentration and muscle torque during recovery following intense exercise

The present study investigated the relationship between plasma potassium ion concentration ([K+]) and skeletal muscle torque during three different 15-min recovery periods after fatigue induced by four 30-s sprints. Four males and one female completed the multiple sprint exercise on three separate days; recovery was passive, i.e. no cycling exercise (PRec), active cycling at 30% peak oxygen consumption (V) over dot(2peak) (30% Rec) and active cycling at 60% (V) over dot(2peak) (60% Rec). Plasma [K+] was measured from blood sampled from an antecubital vein of subjects at rest and at 0, 3, 5, 10 and 15 min into each recovery. Isokinetic leg strength was measured at rest and at 1, 6, 11 and 16 min during each recovery. Following the exhaustive sprints; [K+] increased significantly from an average mean (SEM) resting value of 3.81 (0.07) mmol.l(-1) to 4.48 (0.19) mmol.l(-1) (P < 0.01). In all recovery conditions, plasma [K+] returned to resting levels within 3 min following the fourth sprint. However, in the two active recovery conditions plasma [K+] increased over the remainder of the recovery periods to 4.36 (0.12) mmol.l(-1) in the 30% Rec condition and 4.62 (0.12) mmol.l(-1) in the 60% Rec condition, the latter being significantly higher than the former (P < 0.01). The maximum torque measured following the sprints decreased significantly, on average, to 61.1 (8.36)% of peak levels (P < 0.01). After 15 min of recovery, maximum torque was highest in the 30% Rec condition at 92.13 (3.06)% of peak levels (P < 0.01), compared to 85.23 (3.64)% and 85.71 (0.82)% for the PRec and 60% Rec conditions, respectively. In contrast to the significant differences in plasma [K+] across all three recovery conditions, muscle torque recovery was significantly different in only the 30% Rec condition. In summary, recovery of peak levels of muscle torque following fatiguing exercise does not appear to follow changes in plasma [K+].