859 resultados para Nonideal Solutions
Resumo:
The stress relaxation behaviour of two frozen sucrose solutions (7% and 19%) during indentation in the temperature range of -20C to -40C were investigated. The stress relaxation is similar to that of pure polycrystalline ice, which is controlled by steady-state creep. The steady state creep rate exponent, m, of 7% and 19% sucrose solutions lies between 2.3 and 3.6. The steady state creep rate constant, B, of 19% sucrose solution is greater than that of 7% sucrose solution. It is suggested that the steady-state creep rate exponent m depends on contributions from the proportions of favourably oriented grains, unfavourably oriented grains and grain boundaries to creep and that these components depend on the value of internal stress which is related to the hardness of samples at the different testing temperatures. The steady-state creep rate constant B depends on the mobility of dislocations in sucrose solutions which, in turn, depends on the temperature and the concentration of sucrose.
Resumo:
beta-Casein and alpha-casein showed radical-scavenging activities in aqueous solution, whereas bovine serum albumin (BSA), alpha-lactalbumin and P-lactoglobulin showed much weaker antioxidant activity, when assessed by the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) radical-scavenging assay. However, beta-casein and alpha-casein showed reduced antioxidant activity after storage at 30 degrees C. An increase in radical- scavenging activity and a fall in fluorescence of the protein component were evident after 6 h, when BSA, beta-lactoglobulin or casein were mixed with EGCG, and excess EGCG was removed, indicating the formation of a complex with this protein on mixing. Storage of all the proteins with EGCG at 30 degrees C caused an increase in the antioxidant activity of the isolated protein component after separation from excess EGCG. This showed that EGCG was reacting with the proteins and that the protein-bound catechin had antioxidant properties. The reaction of EGCG with BSA, casein and beta-lactoglobulin was confirmed by the loss of fluorescence of the protein on storage, and the increase in UV absorbance between 250 and 400 nm. The increase in antioxidant activity of BSA after storage with EGCG was confirmed by the ferric reducing antioxidant potential (FRAP) and the oxygen radical antioxidant capacity (ORAC) assays. (c) 2006 Elsevier Ltd. All rights reserved.
Resumo:
The phase separation behaviour in aqueous mixtures of poly(methyl vinyl ether) and hydroxypropylcellulose has been studied by cloud points method and viscometric measurements. The miscibility of these blends in solid state has been assessed by infrared spectroscopy; methanol vapours sorption experiments and scanning electron microscopy. The values of Gibbs energy of mixing of the polymers and their blends with methanol as well as between each other were calculated. It was found that in solid state the polymers can interact with methanol very well but the polymer-polymer interactions are unfavourable. Although in aqueous solutions the polymers exhibit some intermolecular interactions their solid blends are not completely miscible. (C) 2005 Elsevier Ltd. All rights reserved.
Resumo:
The interactions between hydroxypropylmethylcellulose (HPMC) and poly(acrylic acid) (PAA) as well as poly(methacrylic acid) (PMMA) resulting in formation of hydrophobic interpolymer complexes (IPC) via hydrogen bonding have been studied in aqueous solutions in acidic medium. The formation of IPC of two different compositions (2:1 and 4:1) has been detected for complexes of PAA and HPMC. The critical pH values for complexation of HPMC with PAA and PMAA were determined by the turbidimetric method. It was found that PAA shows the lower complexation ability compared to PMAA due to the more hydrophobic nature of the latter polyacid. The temperature-induced phase separation in HPMC-PAA solution mixtures depends greatly on the components ratio and PAA molecular weight. The complexation ability of hydroxypropylmethylcellulose with respect to poly(acrylic acid) was found to be similar to the complexation ability of methylcellulose, lower than that of hydroxypropylcellulose and higher than that of hydroxyethylcellulose. (c) 2006 Society of Chemical Industry.
Resumo:
This paper examines optimal solutions of control systems with drift defined on the orthonormal frame bundle of particular Riemannian manifolds of constant curvature. The manifolds considered here are the space forms Euclidean space E-3, the spheres S-3 and the hyperboloids H-3 with the corresponding frame bundles equal to the Euclidean group of motions SE(3), the rotation group SO(4) and the Lorentz group SO(1,3). The optimal controls of these systems are solved explicitly in terms of elliptic functions. In this paper, a geometric interpretation of the extremal solutions is given with particular emphasis to a singularity in the explicit solutions. Using a reduced form of the Casimir functions the geometry of these solutions are illustrated.
Resumo:
A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.
Resumo:
A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.
Resumo:
A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.
Resumo:
This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.