Enhancement of human adipose-derived stem cell expansion and stability for clinical use

Co-culture techniques associating both dermal fibroblasts and epidermal keratinocytes have shown to have better clinical outcome than keratinocyte culture alone for the treatment of severe burns. Since fat grafting has been shown to improve scar remodelling, new techniques such as cell-therapy-assisted surgical reconstruction with isolated and expanded autologous adipose-derived stem cells (ASCs) would be of benefit to increase graft acceptation. Therefore, integrating ASCs into standardized procedures for cultured skin grafting could be of benefit for the patient if cell quality and quantity could be maintained. The purpose of this study was to evaluate ASC processing from adult tissue with simple isolation (without enzymatic steps), expansion (low density of 325-3,000 cells/cm2) and storage conditions to assure methods to enhance the cellular resistance when transferred back to the patient. Co-culture with cell-banked skin progenitor cells (FE002-SK2) showed an increase of 40-50% ASCs yield at high passages alongside with a better preservation of morphology, proper adipogenic and osteogenic differentiation and efficient biocompatibility with 3D collagen scaffolds. ASCs can be considered as a valuable additional cell source to be delivered in biological bandages to the patient in a need of tissue reconstruction such as burn patients.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Effects of IL-10 and glucose on expression of OPG and RANKL in human periodontal ligament fibroblasts

The effects of interleukin-10 (IL-10) and glucose on mRNA and protein expression of osteoprotegerin (OPG), and its ligand, receptor activator of nuclear factor-κB ligand (RANKL), were investigated in human periodontal ligament fibroblasts (HPDLFs). Primary HPDLFs were treated with different concentrations of IL-10 (0, 1, 10, 25, 50, and 100 ng/mL) or glucose (0, 5.5, 10, 20, 30, and 40 mmol/L). Changes in mRNA and protein expression were examined using the reverse-transcription polymerase chain reaction (RT-PCR) and Western blot analysis, respectively. After IL-10 treatment, mRNA and protein levels of OPG were increased, while mRNA and protein levels of RANKL were decreased (P<0.05), both in a concentration-dependent manner. Glucose stimulation had the opposite concentration-dependent effect to that of IL-10 on OPG and RANKL expression. IL-10 upregulated OPG expression and downregulated RANKL expression, whereas high glucose upregulated RANKL and downregulated OPG in HDPLFs. Abnormal levels of IL-10 and glucose may contribute to the pathogenesis of periodontal disease.

A Survey of hMLH1 mRNA Splicing Profiles in Human Cell Lines: Comparing Primary Cultured Fibroblasts Before and After Oxidative Stress and Transiently versus Stably Demethylated Colon Cancer Derived Cell Lines

Most human genes undergo alternative splicing and loss of splicing fidelity is associated with disease. Epigenetic silencing of hMLH 1 via promoter cytosine methylation is causally linked to a subset of sporadic non-polyposis colon cancer and is reversible by 5-aza-2' -deoxycytidine treatment. Here I investigated changes in hMLHI mRNA splicing profiles in normal fibroblasts and colon cancer-derived human cell lines. I established the types and frequencies of hMLHI mRNA transcripts generated under baseline conditions, after hydrogen peroxide induced oxidative stress, and in acutely 5-aza-2' -deoxycytidine-treated and stably derepressed cancer cell lines. I found that hMLHI is extensively spliced under all conditions including baseline (50% splice variants), the splice variant distribution changes in response to oxidative stress, and certain splice variants are sensitive to 5- aza-2' -deoxycytidine treatment: Splice variant diversity and frequency of exon 17 skipping correlates with the level of hMLHI promoter methylation suggesting a link between promoter methylation and mRNA splicing.

The collagen stimulating effect of peptide amphiphile C16-KTTKS on human fibroblasts

The collagen production of human dermal and corneal fibroblasts in contact with solutions of the peptide amphiphile (PA) C16–KTTKS is investigated and related to its self-assembly into nanotape structures. This PA is used in antiwrinkle cosmeceutical applications (trade name Matrixyl). We prove that C16–KTTKS stimulates collagen production in a concentration-dependent manner close to the critical aggregation concentration determined from pyrene fluorescence spectroscopy. This suggests that self-assembly and the stimulation of collagen production are inter-related.

Collagen stimulating effect of peptide amphiphile C16−KTTKS on human fibroblasts

The collagen production of human dermal and corneal fibroblasts in contact with solutions of the peptide amphiphile (PA) C16−KTTKS is investigated and related to its self-assembly into nanotape structures. This PA is used in antiwrinkle cosmeceutical applications (trade name Matrixyl). We prove that C16−KTTKS stimulates collagen production in a concentration-dependent manner close to the critical aggregation concentration determined from pyrene fluorescence spectroscopy. This suggests that self-assembly and the stimulation of collagen production are inter-related.

CPDs and 6-4PPs play different roles in UV-induced cell death in normal and NER-deficient human cells

Ultraviolet (UV) light generates two major DNA lesions: cyclobutane pyrimidine dimers (CPDs) and pyrimidine-(6-4)-pyrimidone photoproducts (6-4PPs), but the specific participation of these two lesions in the deleterious effects of UV is a longstanding question. In order to discriminate the precise role of unrepaired CPDs and 6-4PPs in UV-induced responses triggering cell death, human fibroblasts were transduced by recombinant adenoviruses carrying the CPD-photolyase or 6-4PP-photolyase cDNAs. Both photolyases were able to prevent UV-induced apoptosis in cells deficient for nucleotide excision repair (NER) to a similar extent, while in NER-proficient cells UV-induced apoptosis was prevented only by CPD-photolyase, with no effects observed when 6-4PPs were removed by the specific photolyase. These results strongly suggest that both CPDs and 6-4PPs contribute to UV-induced apoptosis in NER-deficient cells, while in NER-proficient cells, CPDs are the only lesions responsible for UV-killing, probably due to the rapid repair of 6-4PPs by NER. As a consequence, the difference in skin photosensitivity, including carcinogenesis, of most of the xeroderma pigmentosum patients and of normal people is probably not only a quantitative aspect, but depends on the type of DNA damage induced by sunlight and its rate of repair. (c) 2007 Elsevier B.V. All rights reserved.

Viability of human fibroblasts in coconut water as a storage medium

P>AimTo evaluate the effectiveness of a new storage medium for avulsed teeth, coconut water, in maintaining the viability of human fibroblasts.MethodologyCell viability after different time periods was evaluated in the following storage media: coconut water, coconut water with sodium bicarbonate, milk, saline and still mineral water. Human fibroblasts were seeded in Eagle's minimal essential medium (EMEM) supplemented with 7.5% foetal calf serum. After trypsinisation, 100 mu L of culture medium containing approximately 10(4) cells mL(-1) were collected and pipetted into the wells of 96-well plates, which were incubated overnight in 5% CO(2) and 95% air mixture at 37 degrees C. EMEM was then replaced by the storage media and the plates were incubated at 37 degrees C for 1, 2 and 4 h. Cell viability was determined using the neutral red assay. The proportions of viable cells after exposure to the storage media were analysed statistically by anova and the least significant difference (LSD) test (alpha = 5%).ResultsMilk had the greatest capacity to maintain cell viability (P < 0.05), followed by coconut water with sodium bicarbonate and saline. Coconut water was significantly worse at maintaining cell viability compared to milk, coconut water with sodium bicarbonate and saline. The smallest number of viable cells was observed for mineral water (P < 0.05).ConclusionCoconut water was worse than milk in maintaining human fibroblast cell viability.

Inflammatory reaction to the human bot-fly, Dermatobia hominis, in infested and reinfested mice

Two groups of mice were infested with first stage larvae of the human bot-fly, Dermatobia hominis (Linnaeus Jr) (Diptera: Oestridae). In the first group, skin biopsies were carried out 1, 3, 5, 7, 10 and 18 days after infestation. The second group was also infested but had all the larvae removed 5 days after infestation. The mice in the latter group were reinfested 4 weeks later and skin biopsies were carried out 1, 3, 5, 7, 10 and 18 days after reinfestation. In the first group, an inflammatory reaction began slowly, the neutrophils being the main inflammatory cells, eosinophils being scarce. The reaction progressed with time, developing a necrotic halo around the larvae containing inflammatory cells surrounded by fibroblasts. The inflammation invaded the adjacent tissue. In the second group, the inflammatory reaction was intense on the day immediately after reinfestation, the pattern being changed by the presence of a large number of eosinophils. Activated fibroblasts surrounding the necrotic area around the larvae appeared 3 days after reinfestation in the second group and 7 days after infestation in the first group. The results demonstrated that the previous contact with the antigens elicited the early arrival of eosinophils, probably through the chemotactic factors liberated by mast cells in the anaphylactic reaction.

Opposite effects of bFGF and TGF-beta on collagen metabolism by human periodontal ligament fibroblasts

This study evaluated the effects of bFGF and TGF-beta, individually and combined, on cell proliferation and collagen metabolism. Primary human periodontal ligament cells were stimulated with two concentrations (I and 10 ng/ml) of each growth factor, both individually and combined. Proliferation was determined by a commercial biochemical assay. Real time RT-PCR determined gene expression of NMP-1 and -2, collagen types I and III, TIMP-1, -2 and -3. Autocrine effects on synthesis of bFGF and TGF-beta were evaluated by ELISA. Only TGF-beta, either isolated or associated with bFGF, significantly increased cell proliferation. TGF-beta had anabolic effects, increasing expression of type I and III collagen as well as of TIMPs, whereas bFGF had opposite effects. When bFGF and TGF-beta were associated, the anabolic effects prevailed. Synthesis of TGF-beta was induced only by the association of lower concentrations of the growth factors, whereas there was a dose-dependent production of bFGF. It is concluded that bFGF had a predominantly catabolic effect, and TGF-beta exerted an anabolic effect on hPDL cells. (c) 2007 Elsevier Ltd. All rights reserved.

Human herpesvirus type 6 and type 1 infection increases susceptibility to nonmelanoma skin tumors

In order to investigate herpesvirus (HHV) role in the susceptibility to skin cancer, we compared HHV6 and HHV1 incidence in DNA samples extracted from 120 lesions and 41 normal skin tissues. HHV6 (31.7%) and HHV1 (23.8%) were detected more frequently in skin cancer than in control individuals (14.6 and 5%, respectively) (P=0.0391 and P=0.00094, respectively). The risk of presenting basal cell carcinomas (BCC) was more than 3 times higher for HHV-6 infected patients (OR=3.182; 95% CI: 1.125-8.997). The risk for HHV-1 infected individuals of presenting BCC and squamous cell carcinomas was increased 8 and 6 times, respectively (OR=8.125; 95% CI: 1.735-38.043 and OR=6.290; 95% CI: 1.283-30.856, respectively). (c) 2004 Elsevier B.V.. All rights reserved.

In vitro biocompatibility of poly(vinylidene fluoride-trifluoroethylene)/barium titanate composite using cultures of human periodontal ligament fibroblasts and keratinocytes

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Heat-killed Enterococcus faecalis Alters Nitric Oxide and CXCL12 Production but not CXCL8 and CCL3 Production by Cultured Human Dental Pulp Fibroblasts

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Expression of human leucocyte antigen-G primarily targets affected skin of patients with psoriasis

P>BackgroundThe nonclassical human leucocyte antigen (HLA)-G molecule has been well recognized as a tolerogenic molecule and few studies have evaluated the role of the molecule in inflammatory cutaneous autoimmune diseases.ObjectivesTo evaluate the expression of HLA-G in skin specimens of patients with psoriasis and to analyse its correlation with epidemiological and clinical variables.MethodsThirty untreated patients with psoriasis and 32 healthy individuals were enrolled. Immunohistochemistry was applied to identify HLA-G expression in formalin-fixed paraffin-embedded cutaneous skin biopsies.ResultsSoluble and membrane-bound HLA-G expression was detected in 30 (90%) of the skin specimens from patients presenting clinical and histopathological features of psoriasis. Although infiltrating lymphomononuclear cells of the dermis exhibited HLA-G expression, the epidermis was primarily targeted. HLA-G expression was also observed in 27% (three of 11) of the specimens that exhibited no clinical and histopathological features of psoriasis (nonaffected areas). In contrast, skin specimens obtained from healthy individuals exhibited no HLA-G expression (P < 0 center dot 0001). The intensity of HLA-G expression was not associated with type I/II psoriasis, Psoriasis Area and Severity Index score or clinical forms.ConclusionsAs the HLA-G molecule was consistently expressed in affected and, to a lesser extent, in nonaffected areas of untreated patients with psoriasis, irrespective of the severity of the clinical variants, one may hypothesize that the presence of HLA-G may be responsible, at least in part, for the regulation of autoimmune effector cells.

Acellular dermal tissue study: an ultrastructural evaluation of human and porcine derived tissues in a rat model

The purpose of this study was to evaluate the host response of a human and a porcine derived acellular dermal tissue (ADT) implanted in the subcutaneous tissue of a rat model. Two subcutaneous pockets were surgically created along the dorsal midline of 25 rats (5 rats/group). The human ADT was placed superiorly and the porcine ADT, inferiorly. The animals were sacrificed at 07, 15, 30, 60 and 180 postoperative days (PO) and the ADTs and surrounding soft tissues were assessed for ultrastructural evaluation by transmission electron microscopy. The ultrastructural findings were similar in both materials. Normal collagen and elastic fibers bundles were observed during all experimental moments, as well as macrophages presenting cytoplasmic enlargements digesting cellular portions after 15 PO. From 30 until 180 PO, vacuolar structures filled with an amorphous, electron-transparent substance, were present inside and outside the fibroblasts. Both human and porcine ADT showed similar pattern of ultrastructural response when implanted in the subcutaneous tissue of rats. The porcine ADT appears as a good alternative to be used as a biomaterial.