Desenvolvimento de método de determinação de glicerol livre em biodiesel utilizando a técnica de varredura sucessiva de potencial

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Determinação de enantiômeros em extratos vegetais por cromatografia quiral e dicroísmo circular

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Estudo de associação genômica e análise de enriquecimento genético da criotolerância espermática em bovinos da raça Nelore

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Produção in vitro de embriões bovinos do sexo feminino por sexagem de espermatozóides em gradiente de densidade, modificações na maturação e na fecundação in vitro

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Metodologias para avaliação do potencial fisiológico de sementes de rúcula

Pós-graduação em Agronomia - FEIS

Utilização do método de Taguchi na modelagem e otimização de vazios relacionados à solidificação em processo de fundição de aço ABNT 1030

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Desenvolvimento de metodologia qualitativa para identificação de ceftazidima

A partir deste estudo, métodos para análise qualitativa foram desenvolvidos a fim de identificar ceftazidima em matéria-prima e em formulações farmacêuticas. Esses métodos incluíram testes físico-químicos baseados em propriedades químicas por reações clássicas de coloração e testes instrumentais, tais como cromatografia em camada delgada, calorimetria e espectroscopia no ultravioleta. Os resultados foram obtidos diretamente através de identificação visual pela coloração desenvolvida e pela análise dos espectros obtidos nos testes instrumentais. Esses métodos mostraram-se reprodutíveis e rápidos para identificar ceftazidima na presença de outros antibióticos -lactâmicos, podendo ser usados rotineiramente em análises de controle de qualidade. Palavras-chave: Análise qualitativa. Controle de qualidade. Ceftazidima. ABSTRACT Qualitative methods for the identification of ceftazidime In this study, qualitative analytical methods were developed for the identification of ceftazidime in raw material and in pharmaceutical formulations. These methods included physicochemical tests based on chemical properties, performed by classical colorimetric reactions, and instrumental tests, such as thin-layer chromatography, calorimetry and ultraviolet spectroscopy. Results were obtained directly, through the visual identification of the drug by the color developed, and by analyzing the spectra obtained. These methods proved to be reproducible and fast means of identifying ceftazidime in the presence of other beta-lactam antibiotics and may be used for routine quality control tests. Keywords: Qualitative analysis. Quality control. Ceftazidime.

Farmacovigilância no Brasil: a relação entre polimorfi smo de fármacos, efetividade e segurança dos medicamentos

Apesar da política nacional de medicamentos propor que os mesmos tenham qualidade, efi cácia e segurança, os hospitais sentinelas têm recebido notifi cações de queixa técnica, reações adversas e suspeita de inefetividade terapêutica de medicamentos. Este estudo propôs identifi car os tipos de medicamentos notifi cados num hospital da Rede Sentinela, durante 18 meses, por suspeita de inefetividade terapêutica e verifi car a possibilidade de existência de polimorfos do fármaco, através de levantamento bibliográfi co. Foram identifi cadas 31 notifi cações de suspeita de inefetividade terapêutica de medicamentos similares, provenientes de onze fármacos diferentes, dos quais cinco podem apresentar polimorfos. No entanto, não signifi ca que os demais fármacos não apresentem polimorfos, sendo necessários estudos mais prolongados sobre o polimorfi smo, priorizando os estudos de fármacos com histórico de notifi cação de inefetividade terapêutica. Dados do presente estudo sugerem que testes de polimorfos sejam implantados na rotina do controle de qualidade da matéria-prima do fármaco, no desenvolvimento farmacotécnico do medicamento pela indústria farmacêutica e que o órgão sanitário federal exija os testes de polimorfi smo nos estudos de equivalência farmacêutica e estabilidade para o registro e pós-registro de medicamentos similares e genéricos, a fi m de assegurar a reprodutibilidade da qualidade, segurança e efi cácia comprovadas nos estudos in vivo de bioequivalência e biodisponibilidade relativa. Palavras-chave: polimorfi smo; vigilância sanitária; medicamento genérico; medicamento similar

Sazonalidade de ocorrência de mofo cinzento, oídio e manchas bacterianas foliares em dois viveiros de produção de mudas clonais de eucalipto

Pós-graduação em Ciência Florestal - FCA

Desenvolvimento e construção de um fantoma homegêneo de mão para otimização de imagens radiográficas

Pós-graduação em Biologia Geral e Aplicada - IBB

Processo para determinação de glicerol

Processo para determinação de glicerol em que a metodologia de dosagem parte da purificação das enzimas envolvidas no ensaio, a partir de levedura de panificação, uma fonte barata e de fácil obtenção para ser usada no laboratório de controle de qualidade de bebidas e industrias de biocombustível. O objeto da presente patente de invenção consiste em obter preparação enzimática parcialmente purificada da levedura comercial seca de panificação, contendo a glicerol - fosfato oxidase e glicerol quinase, e preparação enzimática bruta de extrato de rabanete (fonte de peroxidase) para montagem de ensaios de dosagens doglicerol, em amostras químicas e biológicas. A presente invenção está relacionada com o processo para obtenção e determinação de substâncias envolvendo a oxidase, quinase e peroxidase.

Aderência aço-concreto: simulação numéricadosensaios de arranchamento pull-out e APULOT usando o programa ATENA

The bond between steel and concrete is essential for the existence of reinforced concrete structures, as both materials act together to absorb structural strain. The bond phenomenon is considered to be complex regarding many factors that affect it. Several types of bond tests have been proposed over years. One is the modified proposed of pull-out test, which was elaborated by Lorrain and Barbosa [1] called APULOT test (Appropriete pull-out-test). Based on experimental results obtained by Vale Silva[2] either by conventional pull-out tests, or by modified pull-out test, APULOT, seeks to know the numeric behavior of bond steel-concrete through a numerical simulation using a calculation code ATENA which is based on the Finite Element Method (FEM). The numerical simulation provided better evaluate the stress distribution and cracking that occurs during the test, thereby becoming a valuable tool to support the experimental project that aims to validation, validation partially or not recommend the modified bond test steel-concrete - APULOT test - as quality control test of structural concrete. The numerical results showed good representation compared to experimental results.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Influence of distance, geometry and number of control stations on quality of local geodetic networks for the purpose of georeferencing of rural properties

The implementation of local geodetic networks for georeferencing of rural properties has become a requirement after publication of the Georeferencing Technical Standard by INCRA. According to this standard, the maximum distance of baselines to GNSS L1 receivers is of 20 km. Besides the length of the baseline, the geometry and the number of geodetic control stations are other factors to be considered in the implementation of geodetic networks. Thus, this research aimed to examine the influence of baseline lengths higher than the regulated limit of 20 km, the geometry and the number of control stations on quality of local geodetic networks for georeferencing, and also to demonstrate the importance of using specific tests to evaluate the solution of ambiguities and on the quality of the adjustment. The results indicated that the increasing number of control stations has improved the quality of the network, the geometry has not influenced on the quality and the baseline length has influenced on the quality; however, lengths higher than 20 km has not interrupted the implementation, with GPS L1 receiver, of the local geodetic network for the purpose of georeferencing. Also, the use of different statistical tests, both for the evaluation of the resolution of ambiguities and for the adjustment, have enabled greater clearness in analyzing the results, which allow that unsuitable observations may be eliminated.

Plantas medicinais abortivas utilizadas por mulheres de UBS: etnofarmacologia e análises cromatográficas por CCD e CLAE

The use of medicinal plants corresponds to an ancient practice, either as an alternative medicine for the cure of several diseases, or as a method of abortion. Nevertheless, the population in general does not know the risks involved in the use of medicinal plants. In this sense, the purpose of the study was to evaluate the consumption rate of medicinal plants by women in a Basic Health Unit (BHU), on order to identify which plant species have been most frequently consumed by them, including during the pregnancy. Through an exploratory questionnaire with 48 women, it was observed that most part of the interviewees had children and the most of them cited Peumus boldus, Baccharis trimera and Cassia angustifolia, which were mainly used for stomach aches or digestives (53%), for colds (23%), menstrual cramps (4%) or to menstruate (2%). The remaining part of the study consisted in the visual and chemical analysis of the plant species cited by the interviewees, including other species that have been popularly used as a method of abortion. Comparative visual analysis of medicinal plants (Group A-C) from four different shops showed the absence of quality control concerning packing specifications and the separation of the plant material to be consumed. The analysis of the chemical profiles of these samples by thin layer chromatography (TLC) and high performance liquid chromatography (HPLC) indicated that those species belonging to the Group C were significantly different from those plants having the same identification, except for Peumus boldus, whose samples were similar in terms of chemical composition.