Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Inhibitor of cytochrome c messenger RNA -protein interaction in stimulated rat skeletal muscle

The purpose of this work was to examine the possible mechanisms for the regulation of cytochrome c gene expression in response to increased contractile activity in rat skeletal muscle. The working hypothesis was that increased contractile activity enhances cytochrome c gene expression through a cis-element. A 110% increase in cytochrome c mRNA concentration was observed in tibialis anterior (TA) muscle after 9 days of chronic stimulation. Similar difference (120%) exists between soleus (SO) muscle of higher contractile activity and white vastus lateralis (WV) muscle of lower contractile activity. These results suggest that the endogenous cytochrome c gene expression is regulated by contractile activity. Cytochrome c-reporter genes were injected into skeletal muscles to identify the cis-element that is responsible for the regulation. Although the data was inconclusive, part of it suggested the importance of the 3$\sp\prime$-untranslated region (3$\sp\prime$-UTR) in mediating the response to increased contractile activity.^ RNA gel mobility shift (GMSA) and ultraviolet (UV) cross-linking assays revealed specific RNA-protein interaction in a 50-nucleotide region of the 3$\sp\prime$-UTR in unstimulated TA muscle. Computer analysis predicted a stem-loop structure of 17 nucleotides, which provides a structural basis for RNA-protein interaction. These 17 nucleotides are 100% conserved among rat, mouse and human cytochrome c genes and their 13 pseudogenes, suggesting a functional role for this region. The RNA-protein interaction was significantly less in highly active SO muscle than in inactive WV muscle and was dramatically decreased in stimulated TA muscle due to a protein inhibitor(s) associated with ribosome. It is possible that cytochrome c mRNAs undergoing translation are subject to a compartmentalized regulatory influence.^ The conclusion from these results is that increases in contractile activity induce or activate a protein inhibitor(s) associated with ribosome in rat skeletal muscle. The inhibitor decreases RNA-protein interaction in the 3$\sp\prime$-UTR of cytochrome c mRNA, which may result in increased mRNA stability and/or translation. ^

Disruption of estrogen signaling does not prevent progesterone action in the estrogen receptor α knockout mouse uterus

Estrogen is known to increase progesterone receptor (PR) levels in the wild-type mouse uterus, and this estrogen induction was thought to be important for progesterone action through the PR. The estrogen receptor α knockout (ERKO) mouse uterus was observed to express PR mRNA that cannot be induced by estrogen. Progesterone action was characterized to determine whether it was diminished in ERKO mice. The PR protein is present in the ERKO uterus at 60% of the level measured in a wild-type uterus. The PR-A and PR-B isoforms are both detected on Western blot, and the ratio of isoforms is the same in both genotypes. Although the level of PR is reduced in the ERKO uterus, the receptor level is sufficient to induce genomic responses, since both calcitonin and amphiregulin mRNAs were increased after progesterone treatment. Finally, the ERKO uterus can be induced to undergo a progesterone-dependent decidual response. Surprisingly, the decidual response is estrogen independent in the ERKO, although it remains estrogen dependent in a wild type. These results indicate that estrogen receptor α modulation of PR levels is not necessary for expression of the PR or genomic and physiologic responses to progesterone in the ERKO uterus.

A cluster of oppositely imprinted transcripts at the Gnas locus in the distal imprinting region of mouse chromosome 2

Imprinted genes tend to occur in clusters. We have identified a cluster in distal mouse chromosome (Chr) 2, known from early genetic studies to contain both maternally and paternally imprinted, but unspecified, genes. Subsequently, one was identified as Gnas, which encodes a G protein α subunit, and there is clinical and biochemical evidence that the human homologue GNAS1, mutated in patients with Albright hereditary osteodystrophy, is also imprinted. We have used representational difference analysis, based on parent-of-origin methylation differences, to isolate candidate imprinted genes in distal Chr 2 and found two oppositely imprinted genes, Gnasxl and Nesp. Gnasxl determines a variant G protein α subunit associated with the trans-Golgi network and Nesp encodes a secreted protein of neuroendocrine tissues. Gnasxl is maternally methylated in genomic DNA and encodes a paternal-specific transcript, whereas Nesp is paternally methylated with maternal-specific expression. Their reciprocal imprinting may offer insight into the distal Chr 2 imprinting phenotypes. Remarkably, Gnasxl, Nesp, and Gnas are all part of the same transcription unit; transcripts for Gnasxl and Nesp are alternatively spliced onto exon 2 of Gnas. This demonstrates an imprinting mechanism in which two oppositely imprinted genes share the same downstream exons.

Ubiquitin-dependent degradation of IκBα is mediated by a ubiquitin ligase Skp1/Cul 1/F-box protein FWD1

Activation of the transcription factor nuclear factor kappa B (NF-κB) is controlled by proteolysis of its inhibitory subunit (IκB) via the ubiquitin-proteasome pathway. Signal-induced phosphorylation of IκBα by a large multisubunit complex containing IκB kinases is a prerequisite for ubiquitination. Here, we show that FWD1 (a mouse homologue of Slimb/βTrCP), a member of the F-box/WD40-repeat proteins, is associated specifically with IκBα only when IκBα is phosphorylated. The introduction of FWD1 into cells significantly promotes ubiquitination and degradation of IκBα in concert with IκB kinases, resulting in nuclear translocation of NF-κB. In addition, FWD1 strikingly evoked the ubiquitination of IκBα in the in vitro system. In contrast, a dominant-negative form of FWD1 inhibits the ubiquitination, leading to stabilization of IκBα. These results suggest that the substrate-specific degradation of IκBα is mediated by a Skp1/Cull 1/F-box protein (SCF) FWD1 ubiquitin-ligase complex and that FWD1 serves as an intracellular receptor for phosphorylated IκBα. Skp1/Cullin/F-box protein FWD1 might play a critical role in transcriptional regulation of NF-κB through control of IκB protein stability.

Choroid plexus epithelial expression of MDR1 P glycoprotein and multidrug resistance-associated protein contribute to the blood–cerebrospinal-fluid drug-permeability barrier

The blood–brain barrier and a blood–cerebrospinal-fluid (CSF) barrier function together to isolate the brain from circulating drugs, toxins, and xenobiotics. The blood–CSF drug-permeability barrier is localized to the epithelium of the choroid plexus (CP). However, the molecular mechanisms regulating drug permeability across the CP epithelium are defined poorly. Herein, we describe a drug-permeability barrier in human and rodent CP mediated by epithelial-specific expression of the MDR1 (multidrug resistance) P glycoprotein (Pgp) and the multidrug resistance-associated protein (MRP). Noninvasive single-photon-emission computed tomography with 99mTc-sestamibi, a membrane-permeant radiopharmaceutical whose transport is mediated by both Pgp and MRP, shows a large blood-to-CSF concentration gradient across intact CP epithelium in humans in vivo. In rats, pharmacokinetic analysis with 99mTc-sestamibi determined the concentration gradient to be greater than 100-fold. In membrane fractions of isolated native CP from rat, mouse, and human, the 170-kDa Pgp and 190-kDa MRP are identified readily. Furthermore, the murine proteins are absent in CP isolated from their respective mdr1a/1b(−/−) and mrp(−/−) gene knockout littermates. As determined by immunohistochemical and drug-transport analysis of native CP and polarized epithelial cell cultures derived from neonatal rat CP, Pgp localizes subapically, conferring an apical-to-basal transepithelial permeation barrier to radiolabeled drugs. Conversely, MRP localizes basolaterally, conferring an opposing basal-to-apical drug-permeation barrier. Together, these transporters may coordinate secretion and reabsorption of natural product substrates and therapeutic drugs, including chemotherapeutic agents, antipsychotics, and HIV protease inhibitors, into and out of the central nervous system.

The lethal mutation of the mouse wasted (wst) is a deletion that abolishes expression of a tissue-specific isoform of translation elongation factor 1α, encoded by the Eef1a2 gene

We have identified the mutation responsible for the autosomal recessive wasted (wst) mutation of the mouse. Wasted mice are characterized by wasting and neurological and immunological abnormalities starting at 21 days after birth; they die by 28 days. A deletion of 15.8 kb in wasted mice abolishes expression of a gene called Eef1a2, encoding a protein that is 92% identical at the amino acid level to the translation elongation factor EF1α (locus Eef1a). We have found no evidence for the involvement of another gene in this deletion. Expression of Eef1a2 is reciprocal with that of Eef1a. Expression of Eef1a2 takes over from Eef1a in heart and muscle at precisely the time at which the wasted phenotype becomes manifest. These data suggest that there are tissue-specific forms of the translation elongation apparatus essential for postnatal survival in the mouse.

SEK1 deficiency reveals mitogen-activated protein kinase cascade crossregulation and leads to abnormal hepatogenesis

SEK1 (MKK4/JNKK) is a mitogen-activated protein kinase activator that has been shown to participate in vitro in two stress-activated cascades terminating with the SAPK and p38 kinases. To define the role of SEK1 in vivo, we studied stress-induced signaling in SEK1−/− embryonic stem and fibroblast cells and evaluated the phenotype of SEK1−/− mouse embryos during development. Studies of SEK1−/− embryonic stem cells demonstrated defects in stimulated SAPK phosphorylation but not in the phosphorylation of p38 kinase. In contrast, SEK1−/− fibroblasts exhibited defects in both SAPK and p38 phosphorylation, demonstrating that crosstalk exists between the stress-activated cascades. Tumor necrosis factor α and interleukin 1 stimulation of both stress-activated cascades are severely affected in the SEK1−/− fibroblast cells. SEK1 deficiency leads to embryonic lethality after embryonic day 12.5 and is associated with abnormal liver development. This phenotype is similar to c-jun null mouse embryos and suggests that SEK1 is required for phosphorylation and activation of c-jun during the organo-genesis of the liver.

Nucleolar localization of the Werner syndrome protein in human cells

Werner Syndrome (WS) is a human genetic disorder with many features of premature aging. The gene defective in WS (WRN) has been cloned and encodes a protein homologous to several helicases, including Escherichia coli RecQ, the human Bloom syndrome protein (BLM), and Saccharomyces cerevisiae Sgs1p. To better define the function of WRN protein we have determined its subcellular localization. Indirect immunofluorescence using polyclonal anti-human WRN shows a predominant nucleolar localization. Studies of WRN mutant cells lines confirmed the specificity of antibody recognition. No difference was seen in the subcellular localization of the WRN protein in a variety of normal and transformed human cell lines, including both carcinomas and sarcomas. The nucleolar localization of human WRN protein was supported by the finding that upon biochemical subcellular fractionation, WRN protein is present in an increased concentration in a subnuclear fraction enriched for nucleolar proteins. We have also determined the subcellular localization of the mouse WRN homologue (mWRN). In contrast to human WRN protein, mWRN protein is present diffusely throughout the nucleus. Understanding the function of WRN in these organisms of vastly differing lifespan may yield new insights into the mechanisms of lifespan determination.

Cell-specific viral targeting mediated by a soluble retroviral receptor-ligand fusion protein

TVA, the cellular receptor for subgroup A avian leukosis viruses (ALV-A) can mediate viral entry when expressed as a transmembrane protein or as a glycosylphosphatidylinositol-linked protein on the surfaces of transfected mammalian cells. To determine whether mammalian cells can be rendered susceptible to ALV-A infection by attaching a soluble form of TVA to their plasma membranes, the TVA-epidermal growth factor (EGF) fusion protein was generated. TVA-EGF is comprised of the extracellular domain of TVA linked to the mature form of human EGF. Flow cytometric analysis confirmed that TVA-EGF is a bifunctional reagent capable of binding simultaneously to cell surface EGF receptors and to an ALV-A surface envelope-Ig fusion protein. TVA-EGF prebound to transfected mouse fibroblasts expressing either wild-type or kinase-deficient human EGF receptors, rendered these cells highly susceptible to infection by ALV-A vectors. Viral infection was blocked specifically in the presence of a recombinant human EGF protein, demonstrating that the binding of TVA-EGF to EGF receptors was essential for infectivity. These studies have demonstrated that a soluble TVA-ligand fusion protein can mediate viral infection when attached to specific cell surfaces, suggesting an approach for targeting retroviral infection to specific cell types.

Inhibition of protease-resistant prion protein formation by porphyrins and phthalocyanines

A central aspect of pathogenesis in the transmissible spongiform encephalopathies or prion diseases is the conversion of normal protease-sensitive prion protein (PrP-sen) to the abnormal protease-resistant form, PrP-res. Here we identify porphyrins and phthalocyanines as inhibitors of PrP-res accumulation. The most potent of these tetrapyrroles had IC50 values of 0.5–1 μM in scrapie-infected mouse neuroblastoma (ScNB) cell cultures. Inhibition was observed without effects on protein biosynthesis in general or PrP-sen biosynthesis in particular. Tetrapyrroles also inhibited PrP-res formation in a cell-free reaction composed predominantly of hamster PrP-res and PrP-sen. Inhibitors were found among phthalocyanines, deuteroporphyrins IX, and meso-substituted porphines; examples included compounds containing anionic, neutral protic, and cationic peripheral substituents and various metals. We conclude that certain tetrapyrroles specifically inhibit the conversion of PrP-sen to PrP-res without apparent cytotoxic effects. The inhibition observed in the cell-free conversion reaction suggests that the mechanism involved direct interactions of the tetrapyrrole with PrP-res and/or PrP-sen. These findings introduce a new class of inhibitors of PrP-res formation that represents a potential source of therapeutic agents for transmissible spongiform encephalopathies.

Mammalian capping enzyme binds RNA and uses protein tyrosine phosphatase mechanism

Mammalian capping enzymes are bifunctional proteins with both RNA 5′-triphosphatase and guanylyltransferase activities. The N-terminal 237-aa triphosphatase domain contains (I/V)HCXXGXXR(S/T)G, a sequence corresponding to the conserved active-site motif in protein tyrosine phosphatases (PTPs). Analysis of point mutants of mouse RNA 5′-triphosphatase identified the motif Cys and Arg residues and an upstream Asp as required for activity. Like PTPs, this enzyme was inhibited by iodoacetate and VO43− and independent of Mg2+, providing additional evidence for phosphate removal from RNA 5′ ends by a PTP-like mechanism. The full-length, 597-aa mouse capping enzyme and the C-terminal guanylyltransferase fragment (residues 211–597), unlike the triphosphatase domain, bound poly (U) and were nuclear in transfected cells. RNA binding was increased by GTP, and a guanylylation-defective, active-site mutant was not affected. Ala substitution at positions required for the formation of the enzyme-GMP capping intermediate (R315, R530, K533, or N537) also eliminated poly (U) binding, while proteins with conservative substitutions at these sites retained binding but not guanylyltransferase activity. These results demonstrate that the guanylyltransferase domain of mammalian capping enzyme specifies nuclear localization and RNA binding. Association of capping enzyme with nascent transcripts may act in synergy with RNA polymerase II binding to ensure 5′ cap formation.

Covalent modification of the homeodomain-interacting protein kinase 2 (HIPK2) by the ubiquitin-like protein SUMO-1

Posttranslational modifications such as ubiquitination and phosphorylation play an important role in the regulation of cellular protein function. Homeodomain-interacting protein kinase 2 (HIPK2) is a member of the recently identified family of nuclear protein kinases that act as corepressors for homeodomain transcription factors. Here, we show that HIPK2 is regulated by a ubiquitin-like protein, SUMO-1. We demonstrate that HIPK2 localizes to nuclear speckles (dots) by means of a speckle-retention signal. This speckle-retention signal contains a domain that interacts with a mouse ubiquitin-like protein conjugating (E2) enzyme, mUBC9. In cultured cells, HIPK2 is covalently modified by SUMO-1, and the SUMO-1 modification of HIPK2 correlates with its localization to nuclear speckles (dots). Thus, our results provide firm evidence that the nuclear protein kinase HIPK2 can be covalently modified by SUMO-1, which directs its localization to nuclear speckles (dots).

Activities and response to DNA damage of latent and active sequence-specific DNA binding forms of mouse p53

The mouse p53 protein generated by alternative splicing (p53as) has amino acid substitutions at its C terminus that result in constitutively active sequence-specific DNA binding (active form), whereas p53 protein itself binds inefficiently (latent form) unless activated by C-terminal modification. Exogenous p53as expression activated transcription of reporter plasmids containing p53 binding sequences and inhibited growth of mouse and human cells lacking functional endogenous p53. Inducible p53as in stably transfected p53 null fibroblasts increased p21WAF1/Cip-1/Sdi and decreased bcl-2 protein steady-state levels. Endogenous p53as and p53 proteins differed in response to cellular DNA damage. p53 protein was induced transiently in normal keratinocytes and fibroblasts whereas p53as protein accumulation was sustained in parallel with induction of p21WAF1/Cip-1/Sdi protein and mRNA, in support of p53as transcriptional activity. Endogenous p53 and p53as proteins in epidermal tumor cells responded to DNA damage with different kinetics of nuclear accumulation and efficiencies of binding to a p53 consensus DNA sequence. A model is proposed in which C-terminally distinct p53 protein forms specialize in functions, with latent p53 forms primarily for rapid non-sequence-specific binding to sites of DNA damage and active p53 forms for sustained regulation of transcription and growth.