In vivo fluctuation of Tax, Foxp3, CTLA-4, and GITR mRNA expression in CD4+CD25+ T cells of patients with human T-lymphotropic virus type 1-associated myelopathy

HTLV-1 Tax expression exerts an inhibitory effect on the Foxp3 transcription factor in CD4+CD25+ T-regulatory cells (Treg). For a better understanding of the role of Tax mRNA in the gene expression of cellular markers we measured Tax, Foxp3, CTLA-4, GITR, TGF-β, and IL-10 mRNA in Treg cells of 50 patients with human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP; 27 women and 23 men; mean age: 56.7 years). The control group consisted of 23 non-infected subjects (12 women and 11 men) with a mean age of 51.3 years. Real-time PCR was used to measure mRNA of Tax proteins and several cellular markers of Treg function. Determinations revealed a high level of Tax mRNA in HAM/TSP (124.35 copies/100 CD4+CD25+ T cells). Foxp3, GITR, and CTLA-4 mRNA levels were lower in HAM/TSP patients (mean ± SD, 22.07 ± 0.78, 9.63 ± 0.36, and 4.54 ± 0.39, respectively) than in non-infected controls (47.15 ± 12.94, 22.14 ± 1.91, and 21.07 ± 2.31). Both groups had similar levels of TGF-β and IL-10. An inverse relationship was found between Tax levels and Foxp3, CTLA-4, and GITR levels. Conversely, there was a direct correlation between levels of Foxp3, GITR, and CTLA-4. Disease severity and evolution time did not correlate with Tax or Foxp3 levels. The present results suggest that Tax and Foxp3 mRNA vary with the same degree of disease severity in HAM/TSP patients. Tax fluctuations may affect CTLA-4 and GITR expression via the Foxp3 pathway, causing virus-induced dysfunction of CD4+CD25+ T cells in HAM/TSP patients.

Drag reduction by polyethylene glycol in the tail arterial bed of normotensive and hypertensive rats

This study was designed to evaluate the effect of drag reducer polymers (DRP) on arteries from normotensive (Wistar) and spontaneously hypertensive rats (SHR). Polyethylene glycol (PEG 4000 at 5000 ppm) was perfused in the tail arterial bed with (E+) and without endothelium (E-) from male, adult Wistar (N = 14) and SHR (N = 13) animals under basal conditions (constant flow at 2.5 mL/min). In these preparations, flow-pressure curves (1.5 to 10 mL/min) were constructed before and 1 h after PEG 4000 perfusion. Afterwards, the tail arterial bed was fixed and the internal diameters of the arteries were then measured by microscopy and drag reduction was assessed based on the values of wall shear stress (WSS) by computational simulation. In Wistar and SHR groups, perfusion of PEG 4000 significantly reduced pulsatile pressure (Wistar/E+: 17.5 ± 2.8; SHR/E+: 16.3 ± 2.7%), WSS (Wistar/E+: 36; SHR/E+: 40%) and the flow-pressure response. The E- reduced the effects of PEG 4000 on arteries from both groups, suggesting that endothelial damage decreased the effect of PEG 4000 as a DRP. Moreover, the effects of PEG 4000 were more pronounced in the tail arterial bed from SHR compared to Wistar rats. In conclusion, these data demonstrated for the first time that PEG 4000 was more effective in reducing the pressure-flow response as well as WSS in the tail arterial bed of hypertensive than of normotensive rats and these effects were amplified by, but not dependent on, endothelial integrity. Thus, these results show an additional mechanism of action of this polymer besides its mechanical effect through the release and/or bioavailability of endothelial factors.

Leptin receptor (Ob-R) mRNA expression and serum leptin concentration in patients with colorectal and metastatic colorectal cancer

The objective of the present study was to investigate the effect of leptin on the progression of colorectal carcinoma to metastatic disease by analyzing the serum leptin concentration and Ob-R gene expression in colon cancer tissues. Tissue samples were obtained from 31 patients who underwent surgical resection for colon (18 cases) and metastatic colon (13 cases) cancer. Serum leptin concentration was determined by an enzyme-linked immunosorbent assay (ELISA) and Ob-R mRNA expression by real-time polymerase chain reaction (RT-PCR) for both groups. ELISA data were analyzed by the Student t-test and RT-PCR data were analyzed by the Mann-Whitney U-test. RT-PCR results demonstrated that mRNA expression of Ob-R in human metastatic colorectal cancer was higher than in local colorectal cancer tissues. On the other hand, mean serum leptin concentration was significantly higher in local colorectal cancer patients compared to patients with metastatic colorectal cancer. The results of the present study suggest a role for leptin in the progression of colon cancer to metastatic disease without weight loss. In other words, significantly increased Ob-R mRNA expression and decreased serum leptin concentration in patients with metastatic colon cancer indicate that sensitization to leptin activity may be a major indicator of metastasis to the colon tissue and the determination of leptin concentration and leptin gene expression may be used to aid the diagnosis.

Poly(3-hydroxybutyrate-co-3-hydroxyhexanoate)-based scaffolds for tissue engineering

Development and selection of an ideal scaffold is of importance for tissue engineering. Poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx) is a biocompatible bioresorbable copolymer that belongs to the polyhydroxyalkanoate family. Because of its good biocompatibility, PHBHHx has been widely used as a cell scaffold for tissue engineering. This review focuses on the utilization of PHBHHx-based scaffolds in tissue engineering. Advances in the preparation, modification, and application of PHBHHx scaffolds are discussed.

Downregulation of TIM-3 mRNA expression in peripheral blood mononuclear cells from patients with systemic lupus erythematosus

The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (rs=0.283, P=0.049) and serum albumin (rs=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; rs=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.

B cells expressing IL-10 mRNA modulate memory T cells after DNA-Hsp65 immunization

In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon γ, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.

Modification of commercial poly-lactide for extrusion coated food packaging applications

Poly-L-lactide (PLLA) is a widely used sustainable and biodegradable alternative to replace synthetic non-degradable plastic materials in the packaging industry. Conversely, its processing properties are not always optimal, e.g. insufficient melt strength at higher temperatures (necessary in extrusion coating processes). This thesis reports on research to improve properties of commercial PLLA grade (3051D from NatureWorks), to satisfy and extend end-use applications, such as food packaging by blending with modified PLLA. Adjustment of the processability by chain branching of commercial poly-L-lactide initiated by peroxide was evaluated. Several well-defined branched structures with four arms (sPLLA) were synthesized using pentaerythritol as a tetra-functional initiator. Finally, several block copolymers consisting of polyethylene glycol and PLLA (i.e. PEGLA) were produced to obtain a well extruded material with improved heat sealing properties. Reactive extrusion of poly-L-lactide was carried out in the presence of 0.1, 0.3 and 0.5 wt% of various peroxides [tert-butyl-peroxybenzoate (TBPB), 2,5-dimethyl-2,5-(tert-butylperoxy)-hexane (Lupersol 101; LOL1) and benzoyl peroxide (BPO)] at 190C. The peroxide-treated PLLAs showed increased complex viscosity and storage modulus at lower frequencies, indicating the formation of branched/cross linked architectures. The material property changes were dependent on the peroxide, and the used peroxide concentration. Gel fraction analysis showed that the peroxides, afforded different gel contents, and especially 0.5 wt% peroxide, produced both an extremely high molar mass, and a cross linked structure, not perhaps well suited for e.g. further use in a blending step. The thermal behavior was somewhat unexpected as the materials prepared with 0.5 wt% peroxide showed the highest ability for crystallization and cold crystallization, despite substantial cross linking. The peroxide-modified PLLA, i.e. PLLA melt extruded with 0.3 wt% of TBPB and LOL1 and 0.5 wt% BPO was added to linear PLLA in ratios of 5, 15 and 30 wt%. All blends showed increased zero shear viscosity, elastic nature (storage modulus) and shear sensitivity. All blends remained amorphous, though the ability of annealing was improved slightly. Extrusion coating on paperboard was conducted with PLLA, and peroxide-modified PLLA blends (90:10). All blends were processable, but only PLLA with 0.3 wt% of LOL1 afforded a smooth high quality surface with improved line speed. Adhesion levels between fiber and plastic, as well as heat seal performance were marginally reduced compared with pure 3051D. The water vapor transmission measurements (WVTR) of the blends containing LOL1 showed acceptable levels, only slightly lower than for comparable PLLA 3051D. A series of four-arm star-shaped poly-L-lactide (sPLLA) with different branch length was synthesized by ring opening polymerization (ROP) of L-lactide using pentaerythritol as initiator and stannous octoate as catalyst. The star-shaped polymers were further blended with its linear resin and studied for their melt flow and thermal properties. Blends containing 30 wt% of sPLLA with low molecular weight (30 wt%; Mwtotal: 2500 g mol-1 and 15000 g mol-1) showed lower zero shear viscosity and significantly increased shear thinning, while at the same time slightly increased crystallization of the blend. However, the amount of crystallization increased significantly with the higher molecular weight sPLLA, therefore the star-shaped structure may play a role as nucleating agent. PLLA-polyethylene glycol–PLLA triblock copolymers (PEGLA) with different PLLA block length were synthesized and their applicability as blends with linear PLLA (3051D NatureWorks) was investigated with the intention of improving heat-seal and adhesion properties of extrusion-coated paperboard. PLLA-PEG-PLLA was obtained by ring opening polymerization (ROP) of L-lactide using PEG (molecular weight 6000 g mol-1) as an initiator, and stannous octoate as catalyst. The structures of the PEGLAs were characterized by proton nuclear magnetic resonance spectroscopy (1H-NMR). The melt flow and thermal properties of all PEGLAs and their blends were evaluated using dynamic rheology, and differential scanning calorimeter (DSC). All blends containing 30 wt% of PEGLAs showed slightly higher zero shear viscosity, higher shear thinning and increased melt elasticity (based on tan delta). Nevertheless, no significant changes in thermal properties were distinguished. High molecular weight PEGLAs were used in extrusion coating line with 3051D without problems.

Phase transitions in biodegradable films based on blends of gelatin and poly (vinyl alcohol)

The aim of this work was to study the effect of the hydrolysis degree (HD) and the concentration (C PVA) of two types of poly (vinyl alcohol) (PVA) and the effect of the type and the concentration of plasticizers on the phase properties of biodegradable films based on blends of gelatin and PVA, using a response-surface methodology. The films were made by casting and the studied properties were their glass (Tg) and melting (Tm) transition temperatures, which were determined by diferential scanning calorimetry (DSC). For the data obtained on the first scan, the fitting of the linear model was statistically significant and predictive only for the second melting temperature. In this case, the most important effect on the second Tm of the first scan was due to the HD of the PVA. In relation to the second scan, the linear model could be fit to Tg data with only two statistically significant parameters. Both the PVA and plasticizer concentrations had an important effect on Tg. Concerning the second Tm of the second scan, the linear model was fit to data with two statistically significant parameters, namely the HD and the plasticizer concentration. But, the most important effect was provoked by the HD of the PVA.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

A Survey of hMLH1 mRNA Splicing Profiles in Human Cell Lines: Comparing Primary Cultured Fibroblasts Before and After Oxidative Stress and Transiently versus Stably Demethylated Colon Cancer Derived Cell Lines

Most human genes undergo alternative splicing and loss of splicing fidelity is associated with disease. Epigenetic silencing of hMLH 1 via promoter cytosine methylation is causally linked to a subset of sporadic non-polyposis colon cancer and is reversible by 5-aza-2' -deoxycytidine treatment. Here I investigated changes in hMLHI mRNA splicing profiles in normal fibroblasts and colon cancer-derived human cell lines. I established the types and frequencies of hMLHI mRNA transcripts generated under baseline conditions, after hydrogen peroxide induced oxidative stress, and in acutely 5-aza-2' -deoxycytidine-treated and stably derepressed cancer cell lines. I found that hMLHI is extensively spliced under all conditions including baseline (50% splice variants), the splice variant distribution changes in response to oxidative stress, and certain splice variants are sensitive to 5- aza-2' -deoxycytidine treatment: Splice variant diversity and frequency of exon 17 skipping correlates with the level of hMLHI promoter methylation suggesting a link between promoter methylation and mRNA splicing.

Requirements for the selective degradation of CD4 receptor molecules by the human immunodeficiency virus type 1 Vpu protein in the endoplasmic reticulum.

BACKGROUND: HIV-1 Vpu targets newly synthesized CD4 receptor for rapid degradation by a process reminiscent of endoplasmic reticulum (ER)-associated protein degradation (ERAD). Vpu is thought to act as an adaptor protein, connecting CD4 to the ubiquitin (Ub)-proteasome degradative system through an interaction with beta-TrCP, a component of the SCFbeta-TrCP E3 Ub ligase complex. RESULTS: Here, we provide direct evidence indicating that Vpu promotes trans-ubiquitination of CD4 through recruitment of SCFbeta-TrCP in human cells. To examine whether Ub conjugation occurs on the cytosolic tail of CD4, we substituted all four Ub acceptor lysine residues for arginines. Replacement of cytosolic lysine residues reduced but did not prevent Vpu-mediated CD4 degradation and ubiquitination, suggesting that Vpu-mediated CD4 degradation is not entirely dependent on the ubiquitination of cytosolic lysines and as such might also involve ubiquitination of other sites. Cell fractionation studies revealed that Vpu enhanced the levels of ubiquitinated forms of CD4 detected in association with not only the ER membrane but also the cytosol. Interestingly, significant amounts of membrane-associated ubiquitinated CD4 appeared to be fully dislocated since they could be recovered following sodium carbonate salt treatment. Finally, expression of a transdominant negative mutant of the AAA ATPase Cdc48/p97 involved in the extraction of ERAD substrates from the ER membrane inhibited Vpu-mediated CD4 degradation. CONCLUSION: Taken together, these results are consistent with a model whereby HIV-1 Vpu targets CD4 for degradation by an ERAD-like process involving most likely poly-ubiquitination of the CD4 cytosolic tail by SCFbeta-TrCP prior to dislocation of receptor molecules across the ER membrane by a process that depends on the AAA ATPase Cdc48/p97.

Électrofilage de fibres à partir de mélanges polystyrène/poly(vinyl méthyl éther)

L’électrofilage est un procédé permettant de préparer des fibres possédant un diamètre de l’ordre du micromètre ou de quelques centaines de nanomètres. Son utilisation est toutefois limitée par le manque de contrôle sur la structure et les propriétés des fibres ainsi produites. Dans ce travail, des fibres électrofilées à partir de mélanges de polystyrène (PS) et de poly(vinyl méthyl éther) (PVME) ont été caractérisées. La calorimétrie différentielle à balayage (DSC) a montré que les fibres du mélange PS/PVME sont miscibles (une seule transition vitreuse) lorsque préparées dans le benzène, alors qu'une séparation de phases a lieu lorsque le chloroforme est utilisé. Les fibres immiscibles sont néanmoins malléables, contrairement à un film préparé par évaporation du chloroforme qui a des propriétés mécaniques médiocres. Des clichés en microscopies optique et électronique à balayage (MEB) ont permis d’étudier l'effet de la composition et du solvant sur le diamètre et la morphologie des fibres. Des mesures d’angles de contact ont permis d’évaluer l’hydrophobicité des fibres, qui diminue avec l’ajout de PVME (hydrophile); les valeurs sont de 60° supérieures à celles des films de composition équivalente. Un retrait sélectif du PVME a été réalisé par l’immersion des fibres dans l’eau. La spectroscopie infrarouge a montré que la composition passe de 70 à 95% de PS pour une fibre immiscible mais seulement à 75% pour une fibre miscible. Ces résultats indiquent que la phase riche en PVME se situe presque uniquement à la surface des fibres immiscibles, ce qui a été confirmé par microscopie à force atomique (AFM) et MEB. Finalement, l’effet du mélange des deux solvants, lors de l’électrofilage du mélange PS/PVME, a été étudié. La présence du chloroforme, même en quantité réduite, provoque une séparation de phases similaire à celle observée avec ce solvant pur.

Analyse du mécanisme de la dégradation du récepteur CD4 par la protéine Vpu du virus de l'immunodéficience humaine-1 (VIH-1)

Le VIH-1 a développé plusieurs mécanismes menant à la dégradation de son récepteur cellulaire, la molécule CD4, dans le but d’augmenter la relâche de particules virales infectieuses et d’éviter que la cellule soit surinfectée. L’un de ces mécanismes est la dégradation, induite par la protéine virale Vpu, du CD4 nouvellement synthétisé au niveau du réticulum endoplasmique (RE). Vpu doit lier CD4 et recruter l’ubiquitine ligase cellulaire SCFβ-TrCP, via sa liaison à β-TrCP, afin de dégrader CD4. Puisque CD4 doit être retenu au RE pour permettre à Vpu d’induire sa dégradation via le système ubiquitine-protéasome, il a été suggéré que ce processus implique un mécanisme semblable à une voie cellulaire de dégradation des protéines mal-repliées appelée ERAD (« endoplasmic reticulum-associated degradation »). La dégradation par ERAD implique généralement la dislocation des protéines du RE vers le cytoplasme afin de permettre leur poly-ubiquitination et leur dégradation par le protéasome. Nous avons démontré que Vpu induit la poly-ubiquitination de CD4 dans des cellules humaines. Nos résultats suggèrent aussi que CD4 doit subir une dislocation afin d’être dégradé par le protéasome en présence de Vpu. De plus, un mutant transdominant négatif de l’ATPase p97, qui est impliquée dans la dislocation des substrats ERAD, inhibe complètement la dégradation de CD4 par Vpu. Enfin, nos résultats ont montré que l’ubiquitination sur des résidus accepteurs de l’ubiquitine (lysines) de la queue cytoplasmique de CD4 n’était pas essentielle, mais que la mutation des lysines ralentit le processus de dégradation de CD4. Ce résultat suggère que l’ubiquitination de la queue cytosolique de CD4 pourrait représenter un événement important dans le processus de dégradation induit par Vpu. L’attachement de l’ubiquitine a généralement lieu sur les lysines de la protéine ciblée. Toutefois, l’ubiquitination sur des résidus non-lysine (sérine, thréonine et cystéine) a aussi été démontrée. Nous avons démontré que la mutation de tous les sites potentiels d’ubiquitination cytoplasmiques de CD4 (K, C, S et T) inhibe la dégradation par Vpu. De plus, la présence de cystéines dans la queue cytoplasmique apparaît suffisante pour rendre CD4 sensible à Vpu en absence de lysine, sérine et thréonine. Afin d’expliquer ces résultats, nous proposons un modèle dans lequel l’ubiquitination de la queue cytosolique de CD4 serait nécessaire à sa dégradation et où les sites d’ubiquitination de CD4 seraient sélectionnés de façon non spécifique par l’ubiquitine ligase recrutée par Vpu. Enfin, nous avons observé que la co-expression d’une protéine Vpu incapable de recruter β-TrCP (Vpu S52,56/D) semble stabiliser le CD4 qui est retenu au RE. De plus, d’autres mutants de Vpu qui semblent capables de recruter β-TrCP et CD4 sont toutefois incapables d’induire sa dégradation. Ces résultats suggèrent que l’association de Vpu à CD4 et β-TrCP est essentielle mais pas suffisante pour induire la dégradation de CD4. Par conséquent, ces résultats soulèvent la possibilité que Vpu puisse recruter d’autres facteurs cellulaires pour induire la dégradation de CD4. Les résultats présentés ont permis de mieux définir le mécanisme de dégradation de CD4 par Vpu dans des cellules humaines. De plus, ces résultats nous ont permis d’élaborer un modèle dans lequel l’ubiquitine ligase cellulaire SCFβ-TrCP démontre de la flexibilité dans le choix des résidus à ubiquitiner afin d’induire la dégradation de CD4. Enfin, ces études jettent un oeil nouveau sur le rôle de Vpu dans ce processus puisque nos résultats suggèrent que Vpu doive recruter d’autres partenaires cellulaires, mis à part β-TrCP, pour induire la dégradation de CD4.

A mechanism for co-transcriptional recruitment of mRNA localization factor on nascent mRNAs in budding yeast

Le transport et la localisation des ARN messagers permettent de réguler l’expression spatiale et temporelle de facteurs spécifiques impliqués dans la détermination du destin cellulaire, la plasticité synaptique, la polarité cellulaire et la division asymétrique des cellules. Chez S.cerevisiæ, plus de trente transcrits sont transportés activement vers le bourgeon cellulaire. Parmi ces transcrits, l’ARNm ASH1 (asymetric synthesis of HO) est localisé à l’extrémité du bourgeon pendant l’anaphase. Ce processus va entrainer une localisation asymétrique de la protéine Ash1p, qui sera importée uniquement dans le noyau de la cellule fille, où elle entraine le changement de type sexuel. La localisation asymétrique de l’ARNm ASH1, et donc de Ash1p, implique la présence de différents facteurs de localisation. Parmi ces facteurs, les protéines She (She1p/Myo4p, She2p et She3p) et les répresseurs traductionnels (Puf6p, Loc1p et Khd1p) participent à ce mécanisme. La protéine navette She2p est capable de lier l’ARNm ASH1 et va entrainer le ciblage de cet ARNm vers l’extrémité du bourgeon en recrutant le complexe She3p-Myo4p. Des répresseurs traductionnels régulent la traduction de cet ARNm et évitent l’expression ectopique de la protéine Ash1p pendant son transport. Alors que la fonction cytoplasmique de She2p sur la localisation des ARNm est connue, sa fonction nucléaire est encore inconnue. Nous avons montré que She2p contient une séquence de localisation nucléaire non classique qui est essentielle à son import nucléaire médié par l’importine α (Srp1p). L’exclusion de She2p du noyau par mutation de son NLS empêche la liaison de Loc1p et Puf6p sur l’ARNm ASH1, entrainant un défaut de localisation de l’ARNm et de la protéine. Pour étudier plus en détail l’assemblage de la machinerie de localisation des ARNm dans le noyau, nous avons utilisé des techniques d’immunoprécipitation de chromatine afin de suivre le recrutement des facteurs de localisation et des répresseurs traductionnels sur les ARNm naissants. Nous avons montré que She2p est recruté sur le gène ASH1 pendant sa transcription, via son interaction avec l’ARNm ASH1 naissant. Puf6p est également recruté sur ASH1, mais d’une manière dépendante de la présence de She2p. De façon intéressante, nous avons détecté une interaction entre She2p et la plus grande sous-unité de l’ARN polymérase II (Rpb1p). Cette interaction est détectée avec la forme active en élongation de l’ARN polymérase II. Nous avons également démontré que She2p interagit avec le complexe d’élongation de la transcription Spt4p/Spt5p. Une délétion de SPT4 ou une mutation dans SPT5 (Ts spt5) à température restrictive empêche l’interaction entre She2p et Rpb1p, et diminue le recrutement de She2p au gène ASH1, entrainant un défaut de localisation de l’ARNm et un défaut de localisation asymétrique de la protéine Ash1p. De manière globale, nos résultats montrent que les facteurs impliqués dans la localisation cytoplasmique des ARNm et dans leur contrôle traductionnel sont recrutés de façon co-transcriptionnelle sur les ARNm naissants via leur interaction avec la machinerie de transcription, suggèrant un rôle important de la machinerie transcriptionelle dans la localisation des ARNm.