Avaliação de diferentes técnicas de inseminação artificial em éguas utilizando um baixo número de espermatozóides

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Resistência omótica, congelabilidade e fertilidade do sêmen de garanhões frente a diferentes crioprotetores

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Perfil eletroforético, características estruturais e fertilidade in vitro do sêmen de touros Nelores submetidos à degeneração testicular por insulação

Pós-graduação em Medicina Veterinária - FMVZ

Variabilidade das sub-populações de espermatozóides avaliados pela cinética em sistema computadorizado e combinação de sondas fluorescentes como praâmetro quantitativo do sêmen congelado de ovinos

Pós-graduação em Medicina Veterinária - FMVZ

Criopreservação e fertilidade de espermatozoides do ejaculado e recuperados da cauda do epidídimo de garanhões subférteis

Pós-graduação em Medicina Veterinária - FMVZ

Avanços na criopreservação do sêmen ovino I: diluidores e crioprotetores

The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Efeito do tratamento local de vesiculite seminal sobre a qualidade e longevidade so sêmen equino

Pós-graduação em Medicina Veterinária - FMVZ

Prostatic acid phosphatase in serum and semen of dogs

The incidence of prostatic malignancy has increased the use of tissue markers to detect cancer. Tissue specific antigens or differentiation antigens are found on the surface of normal cells. Clinically, these antigens are important to diagnose alterations in the tissues and for immunotherapy. The objective of the present study was to evaluate the prostatic acid phosphatase concentration in blood and seminal plasma of intact and healthy dogs at different ages. The evaluation was carried out by spectrophotometer, using a commercial kit. The prostatic acid phosphatase (PAP) levels did not differ according to the age and did not correlate with age or prostatic dimensions verified by ultrasonography. The PAP concentration values varied greatly within each group. However, more studies are necessary to evaluate the role of prostatic acid phosphatase in the canine prostate and its importance as a diagnostic test for prostate disorders.

Dose-Dependent Effects and Reversibility of the Injuries Caused by Nandrolone Decanoate in Uterine Tissue and Fertility of Rats

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Inducing ovulation early postpartum influences uterine health and fertility in dairy cows

The objective of the current study was to evaluate the effect of GnRH early postpartum on induction of ovulation, uterine health, and fertility in dairy cows. Holstein cows without a corpus luteum (CL) at 17 +/- 3 DIM were assigned randomly to receive i.m. GnRH (n = 245) at 17 +/- 3 and 20 +/- 3 DIM or remain as controls (n = 245). Ovaries were scanned by ultrasonography twice weekly totaling 4 examinations. Ovulation was characterized by the appearance of a CL >= 20 mm at any ultrasound or CL <20 mm in 2 consecutive examinations. Clinical and cytological endometritis were diagnosed at 35 DIM. Compared with control, GnRH increased ovulation up to 3.5 d after the last treatment (78.7 vs. 45.0%) and did not affect the prevalence of clinical endometritis (23.9 vs. 18.6%) or cytological endometritis (30.9 vs. 32.8%). Prevalence of clinical endometritis increased in cows that had calving problems (32.6 vs. 15.9%) and metritis (40.6 vs. 15.8%). Metritis increased prevalence of cytological endometritis (50.7 vs. 23.5%). Treatment with GnRH did not affect pregnancy per artificial insemination at 32 (37.6 vs. 38.6%) or 74 d after artificial insemination (35.0 vs. 31.5%), but reduced pregnancy loss (6.8 vs. 18.1%). No overall effect of GnRH treatment on hazard of pregnancy was observed; however, an interaction between GnRH treatment and ovulation showed that GnRH-treated cows that ovulated had increased hazard of pregnancy by 300 DIM compared with GnRH-treated and control cows that did not ovulate (hazard ratio = 2.0 and 1.3, respectively), but similar to control cows that ovulated (hazard ratio = 1.1). Gonadotropin-releasing hormone early postpartiim induced ovulation without affecting uterine health, but failed to improve pregnancy per artificial insemination or time to pregnancy, although it reduced pregnancy loss.