820 resultados para NIS mRNA poly(A) tail


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The investigation of resistance vessels is generally costly and difficult to execute. The present study investigated the diameters and the vascular reactivity of different segments of the rat tail artery (base, middle, and tail end) of 30 male Wister rats (EPM strain) to characterize a conductance or resistance vessel, using a low-cost simple technique. The diameters (mean ± SEM) of the base and middle segments were 471 ± 4.97 and 540 ± 8.39 µm, respectively, the tail end was 253 ± 2.58 µm. To test reactivity, the whole tail arteries or segments were perfused under constant flow and the reactivity to phenylephrine (PHE; 0.01-300 µg) was evaluated before and after removal of the endothelium or drug administration. The maximal response (Emax) and sensitivity (pED50) to PHE of the whole tail and the base segment increased after endothelium removal or treatment with 100 µM L-NAME, which suggests modulation by nitric oxide. Indomethacin (10 µM) and tetraethylammonium (5 mM) did not change the Emax or pED50 of these segments. PHE and L-NAME increased the pED50 of the middle and the tail end only and indomethacin did not change pED50 or Emax. Tetraethylammonium increased the sensitivity only at the tail end, which suggests a blockade of vasodilator release. Results indicate that the proximal segment of the tail artery possesses a diameter compatible with a conductance vessel, while the tail end has the diameter of a resistance vessel. In addition, the vascular reactivity to PHE in the proximal segment is nitric oxide-dependent, while the tail end is dependent on endothelium-derived hyperpolarizing factor.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of the present study was to assess the effects of endurance training on leptin levels and adipose tissue gene expression and their association with insulin, body composition and energy intake. Male Wistar rats were randomly divided into two groups: trained (N = 18) and sedentary controls (N = 20). The trained group underwent swimming training for 9 weeks. Leptin and insulin levels, adiposity and leptin gene expression in epididymal and inguinal adipose tissue were determined after training. There were no differences in energy intake between groups. Trained rats had a decreased final body weight (-10%), relative and total body fat (-36 and -55%, respectively) and insulin levels (-55%) compared with controls (P < 0.05). Although trained animals showed 56% lower leptin levels (2.58 ± 1.05 vs 5.89 ± 2.89 ng/mL in control; P < 0.05), no difference in leptin gene expression in either fat depot was demonstrable between groups. Stepwise multiple regression analysis showed that lower leptin levels in trained rats were due primarily to their lower body fat mass. After adjustment for total body fat, leptin levels were still 20% (P < 0.05) lower in exercised rats. In conclusion, nine weeks of swimming training did not affect leptin gene expression, but did lead to a decrease in leptin levels that was independent of changes in body fat.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Female rats are intensely affected by cocaine, with estrogen probably playing an important role in this effect. Progesterone modulates the GABA system and attenuates the effects of cocaine; however, there is no information about its relevance in changing GABA synthesis pathways after cocaine administration to female rats. Our objective was to investigate the influence of progesterone on the effects of repeated cocaine administration on the isoenzymes of glutamic acid decarboxylase (GAD65 and GAD67) mRNA in brain areas involved in the addiction circuitry. Ovariectomized, intact and progesterone replacement-treated female rats received saline or cocaine (30 mg/kg, ip) acutely or repeatedly. GAD isoenzyme mRNA levels were determined in the dorsolateral striatum (dSTR) and prefrontal cortex (PFC) by RT-PCR, showing that repeated, but not acute, cocaine decreased GADs/β-actin mRNA ratio in the dSTR irrespective of the hormonal condition (GAD65: P < 0.001; and GAD67: P = 0.004). In the PFC, repeated cocaine decreased GAD65 and increased GAD67 mRNA ratio (P < 0.05). Progesterone replacement decreased both GAD isoenzymes mRNA ratio after acute cocaine in the PFC (P < 0.001) and repeated cocaine treatment reversed this decrease (P < 0.001). These results suggest that cocaine does not immediately affect GAD mRNA expression, while repeated cocaine decreases both GAD65 and GAD67 mRNA in the dSTR of female rats, independently of their hormonal conditions. In the PFC, repeated cocaine increases the expression of GAD isoenzymes, which were decreased due to progesterone replacement.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Estradiol participates in the control of energy homeostasis, as demonstrated by an increase in food intake and in body weight gain after ovariectomy in rats. In the present study, female Wistar rats (200-230 g, N = 5-15 per group), with free access to chow, were individually housed in metabolic cages. We investigated food intake, body weight, plasma leptin levels, measured by specific radioimmunoassay, and the hypothalamic mRNA expression of orexigenic and anorexigenic neuropeptides, determined by real-time PCR, in ovariectomized rats with (OVX+E) and without (OVX) estradiol cypionate treatment (10 µg/kg body weight, sc, for 8 days). Hormonal and mRNA expression were determined at pre-feeding and 4 h after food intake. OVX+E rats showed lower food intake, less body weight gain and lower plasma leptin levels. In the OVX+E group, we also observed a reduction of neuropeptide Y (NPY), agouti-related protein (AgRP) and cocaine- and amphetamine-regulated transcript (CART) mRNA expression in the arcuate nucleus and a decrease in orexin A in the lateral hypothalamic area (LHA). There was an increase in leptin receptor (LepRb), melanocortin-4 receptor (MC4-R), CART, and mainly corticotropin-releasing hormone (CRH) mRNA in the paraventricular nucleus and LepRb and CART mRNA in the LHA. These data show that hypophagia induced by estradiol treatment is associated with reduced hypothalamic expression of orexigenic peptides such as NPY, AgRP and orexin A, and increased expression of the anorexigenic mediators MC4-R, LepRb and CRH. In conclusion, estradiol decreases food intake, and this effect seems to be mediated by peripheral factors such as leptin and the differential mRNA expression of neuropeptides in the hypothalamus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

HTLV-1 Tax expression exerts an inhibitory effect on the Foxp3 transcription factor in CD4+CD25+ T-regulatory cells (Treg). For a better understanding of the role of Tax mRNA in the gene expression of cellular markers we measured Tax, Foxp3, CTLA-4, GITR, TGF-β, and IL-10 mRNA in Treg cells of 50 patients with human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP; 27 women and 23 men; mean age: 56.7 years). The control group consisted of 23 non-infected subjects (12 women and 11 men) with a mean age of 51.3 years. Real-time PCR was used to measure mRNA of Tax proteins and several cellular markers of Treg function. Determinations revealed a high level of Tax mRNA in HAM/TSP (124.35 copies/100 CD4+CD25+ T cells). Foxp3, GITR, and CTLA-4 mRNA levels were lower in HAM/TSP patients (mean ± SD, 22.07 ± 0.78, 9.63 ± 0.36, and 4.54 ± 0.39, respectively) than in non-infected controls (47.15 ± 12.94, 22.14 ± 1.91, and 21.07 ± 2.31). Both groups had similar levels of TGF-β and IL-10. An inverse relationship was found between Tax levels and Foxp3, CTLA-4, and GITR levels. Conversely, there was a direct correlation between levels of Foxp3, GITR, and CTLA-4. Disease severity and evolution time did not correlate with Tax or Foxp3 levels. The present results suggest that Tax and Foxp3 mRNA vary with the same degree of disease severity in HAM/TSP patients. Tax fluctuations may affect CTLA-4 and GITR expression via the Foxp3 pathway, causing virus-induced dysfunction of CD4+CD25+ T cells in HAM/TSP patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was designed to evaluate the effect of drag reducer polymers (DRP) on arteries from normotensive (Wistar) and spontaneously hypertensive rats (SHR). Polyethylene glycol (PEG 4000 at 5000 ppm) was perfused in the tail arterial bed with (E+) and without endothelium (E-) from male, adult Wistar (N = 14) and SHR (N = 13) animals under basal conditions (constant flow at 2.5 mL/min). In these preparations, flow-pressure curves (1.5 to 10 mL/min) were constructed before and 1 h after PEG 4000 perfusion. Afterwards, the tail arterial bed was fixed and the internal diameters of the arteries were then measured by microscopy and drag reduction was assessed based on the values of wall shear stress (WSS) by computational simulation. In Wistar and SHR groups, perfusion of PEG 4000 significantly reduced pulsatile pressure (Wistar/E+: 17.5 ± 2.8; SHR/E+: 16.3 ± 2.7%), WSS (Wistar/E+: 36; SHR/E+: 40%) and the flow-pressure response. The E- reduced the effects of PEG 4000 on arteries from both groups, suggesting that endothelial damage decreased the effect of PEG 4000 as a DRP. Moreover, the effects of PEG 4000 were more pronounced in the tail arterial bed from SHR compared to Wistar rats. In conclusion, these data demonstrated for the first time that PEG 4000 was more effective in reducing the pressure-flow response as well as WSS in the tail arterial bed of hypertensive than of normotensive rats and these effects were amplified by, but not dependent on, endothelial integrity. Thus, these results show an additional mechanism of action of this polymer besides its mechanical effect through the release and/or bioavailability of endothelial factors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effect of leptin on the progression of colorectal carcinoma to metastatic disease by analyzing the serum leptin concentration and Ob-R gene expression in colon cancer tissues. Tissue samples were obtained from 31 patients who underwent surgical resection for colon (18 cases) and metastatic colon (13 cases) cancer. Serum leptin concentration was determined by an enzyme-linked immunosorbent assay (ELISA) and Ob-R mRNA expression by real-time polymerase chain reaction (RT-PCR) for both groups. ELISA data were analyzed by the Student t-test and RT-PCR data were analyzed by the Mann-Whitney U-test. RT-PCR results demonstrated that mRNA expression of Ob-R in human metastatic colorectal cancer was higher than in local colorectal cancer tissues. On the other hand, mean serum leptin concentration was significantly higher in local colorectal cancer patients compared to patients with metastatic colorectal cancer. The results of the present study suggest a role for leptin in the progression of colon cancer to metastatic disease without weight loss. In other words, significantly increased Ob-R mRNA expression and decreased serum leptin concentration in patients with metastatic colon cancer indicate that sensitization to leptin activity may be a major indicator of metastasis to the colon tissue and the determination of leptin concentration and leptin gene expression may be used to aid the diagnosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Development and selection of an ideal scaffold is of importance for tissue engineering. Poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx) is a biocompatible bioresorbable copolymer that belongs to the polyhydroxyalkanoate family. Because of its good biocompatibility, PHBHHx has been widely used as a cell scaffold for tissue engineering. This review focuses on the utilization of PHBHHx-based scaffolds in tissue engineering. Advances in the preparation, modification, and application of PHBHHx scaffolds are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (rs=0.283, P=0.049) and serum albumin (rs=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; rs=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon γ, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Poly-L-lactide (PLLA) is a widely used sustainable and biodegradable alternative to replace synthetic non-degradable plastic materials in the packaging industry. Conversely, its processing properties are not always optimal, e.g. insufficient melt strength at higher temperatures (necessary in extrusion coating processes). This thesis reports on research to improve properties of commercial PLLA grade (3051D from NatureWorks), to satisfy and extend end-use applications, such as food packaging by blending with modified PLLA. Adjustment of the processability by chain branching of commercial poly-L-lactide initiated by peroxide was evaluated. Several well-defined branched structures with four arms (sPLLA) were synthesized using pentaerythritol as a tetra-functional initiator. Finally, several block copolymers consisting of polyethylene glycol and PLLA (i.e. PEGLA) were produced to obtain a well extruded material with improved heat sealing properties. Reactive extrusion of poly-L-lactide was carried out in the presence of 0.1, 0.3 and 0.5 wt% of various peroxides [tert-butyl-peroxybenzoate (TBPB), 2,5-dimethyl-2,5-(tert-butylperoxy)-hexane (Lupersol 101; LOL1) and benzoyl peroxide (BPO)] at 190C. The peroxide-treated PLLAs showed increased complex viscosity and storage modulus at lower frequencies, indicating the formation of branched/cross linked architectures. The material property changes were dependent on the peroxide, and the used peroxide concentration. Gel fraction analysis showed that the peroxides, afforded different gel contents, and especially 0.5 wt% peroxide, produced both an extremely high molar mass, and a cross linked structure, not perhaps well suited for e.g. further use in a blending step. The thermal behavior was somewhat unexpected as the materials prepared with 0.5 wt% peroxide showed the highest ability for crystallization and cold crystallization, despite substantial cross linking. The peroxide-modified PLLA, i.e. PLLA melt extruded with 0.3 wt% of TBPB and LOL1 and 0.5 wt% BPO was added to linear PLLA in ratios of 5, 15 and 30 wt%. All blends showed increased zero shear viscosity, elastic nature (storage modulus) and shear sensitivity. All blends remained amorphous, though the ability of annealing was improved slightly. Extrusion coating on paperboard was conducted with PLLA, and peroxide-modified PLLA blends (90:10). All blends were processable, but only PLLA with 0.3 wt% of LOL1 afforded a smooth high quality surface with improved line speed. Adhesion levels between fiber and plastic, as well as heat seal performance were marginally reduced compared with pure 3051D. The water vapor transmission measurements (WVTR) of the blends containing LOL1 showed acceptable levels, only slightly lower than for comparable PLLA 3051D. A series of four-arm star-shaped poly-L-lactide (sPLLA) with different branch length was synthesized by ring opening polymerization (ROP) of L-lactide using pentaerythritol as initiator and stannous octoate as catalyst. The star-shaped polymers were further blended with its linear resin and studied for their melt flow and thermal properties. Blends containing 30 wt% of sPLLA with low molecular weight (30 wt%; Mwtotal: 2500 g mol-1 and 15000 g mol-1) showed lower zero shear viscosity and significantly increased shear thinning, while at the same time slightly increased crystallization of the blend. However, the amount of crystallization increased significantly with the higher molecular weight sPLLA, therefore the star-shaped structure may play a role as nucleating agent. PLLA-polyethylene glycol–PLLA triblock copolymers (PEGLA) with different PLLA block length were synthesized and their applicability as blends with linear PLLA (3051D NatureWorks) was investigated with the intention of improving heat-seal and adhesion properties of extrusion-coated paperboard. PLLA-PEG-PLLA was obtained by ring opening polymerization (ROP) of L-lactide using PEG (molecular weight 6000 g mol-1) as an initiator, and stannous octoate as catalyst. The structures of the PEGLAs were characterized by proton nuclear magnetic resonance spectroscopy (1H-NMR). The melt flow and thermal properties of all PEGLAs and their blends were evaluated using dynamic rheology, and differential scanning calorimeter (DSC). All blends containing 30 wt% of PEGLAs showed slightly higher zero shear viscosity, higher shear thinning and increased melt elasticity (based on tan delta). Nevertheless, no significant changes in thermal properties were distinguished. High molecular weight PEGLAs were used in extrusion coating line with 3051D without problems.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this work was to study the effect of the hydrolysis degree (HD) and the concentration (C PVA) of two types of poly (vinyl alcohol) (PVA) and the effect of the type and the concentration of plasticizers on the phase properties of biodegradable films based on blends of gelatin and PVA, using a response-surface methodology. The films were made by casting and the studied properties were their glass (Tg) and melting (Tm) transition temperatures, which were determined by diferential scanning calorimetry (DSC). For the data obtained on the first scan, the fitting of the linear model was statistically significant and predictive only for the second melting temperature. In this case, the most important effect on the second Tm of the first scan was due to the HD of the PVA. In relation to the second scan, the linear model could be fit to Tg data with only two statistically significant parameters. Both the PVA and plasticizer concentrations had an important effect on Tg. Concerning the second Tm of the second scan, the linear model was fit to data with two statistically significant parameters, namely the HD and the plasticizer concentration. But, the most important effect was provoked by the HD of the PVA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Comprend : Fol. Diijr° - Sit nomen Domini benedictum in seculum (Fuga, à 4 v.) - Fol. Ej r° - Morior ego, si non habuero (Fuga, à 5 v.) - Fol. Ej r° - Fuga à 5 v. - Fol. Ej v° - Fuga à 2 v. - Fol. Ej v° - Fuga à 5 v. - Fol. Eij r° - Fuga à 5 v. - Fol. Eij v° - Fuga à 2 v. - Fol. Eiij v° - Fuga à 2 v. - Fol. Eiv r° - Fuga à 5 v. - Fol. Eiv v° - Fuga à 2 v. - Fol. F j r° - Canon à 3 v. - Fol. I j v° - Elegantia super Languir me fault (à 2 v.) - Fol. I ij v° - C'est à grant tort (Aliud exemplum, à 2 v.) - Fol. iiij v° - Fuga à 4 v. - Fol. Kiij r° - In omnibus requiem (à 1 v.) - Fol. Kiij v° - Salve sancta parens (à 1 v. (le début d'une autre voix sur la même portée en ms.)) - Fol. Liij r° - Vanitas vanitatum (à 4 v.) - Fol. Liij v° - Dixit Dominus (à 4 v.) - Fol. Liiij r° - Dixit Dominus (à 5 v. et faux-bourdon) - Fol. Liiij v° - O vos omnes (à 4 v.) - Fol. N j r° - Omnis arbor (à 2 v.) - Fol. N j v° - Pleni sunt coeli (à 2 v.) - Fol. Nij v° - Pleni sunt coeli (à 2 v.) - Fol. Niij r° - Christus spes mea (à 3 v.) - Fol. Niij r° - Et expecto resurectionem mortuorum (à 3 v.) - Fol. Niij v° - Pleni sunt coeli (à 3 v.) - Fol. Niiij v° - A solis ortu cardine ([Hymne], à 4 v.) - Fol. O j v° - [Canon] à 4 v. - Fol. O j v° - Revertere (à 4 v.) - Fol. O j v° - Adolescens graditur (à 5 v.) - Fol. Oij r° - Dominus mihi adiutor (Fuga, à 5 v.) - Fol. Oij v° - Surrexit Christus hodie (à 5 v.) - Fol. Oiij v° - Christus pro nobis passus est (à 5 v.) - Fol. Oiiij v° - Agnus Dei (à 6 v.) - Fol. Pj v° - [Pièce sans texte] (à 6 v.) - Fol. Pij v° - Sumite psalmum (Fuga, à 6 v.) - Fol. Pij v° - Nobilis est (Fuga, à 6 v.) - Fol. Piij r° - Ambulate dum lucem habetis (Fuga, à 7 v.) - Fol. Piij r° - Sancta Trinitas (Fuga, à 7 v.) - Fol. Piij v° - Omnis consummationis vidi finem (Canon, à 8 v. dont 4 notées)