Analysis of a human placental lactogen gene promoter

Human placental lactogen (hPL) and human growth hormone (hGH) comprise a multigene family that share $>$90% nucleic acid sequence homology including 500 bp of 5$\sp\prime$ flanking sequence. Despite these similarities, hGH is produced in the anterior pituitary while hPL is expressed in the placenta. For most genes studied to date, regulation of expression occurs by alterations at the level of transcriptional initiation. Nuclear proteins bind specific DNA sequences in the promoter to regulate gene expression. In this study, the hPL$\sb3$ promoter was analyzed for DNA sequences that contribute to its expression. The interaction between the hPL$\sb3$ promoter and nuclear proteins was examined using nuclear extracts from placental and non-placental cells.^ To identify regulatory elements in the promoter of the hPL$\sb3$ gene, 5$\sp\prime$ deletion mutants were constructed by cleaving 1200 bp of upstream sequence with various restriction enzymes. These DNA fragments were ligated 5$\sp\prime$ to a promoterless bacterial gene chloramphenicol acetyltransferase (CAT) and transfected into JEG-3 cells, a human placental choriocarcinoma cell line. The level of CAT activity reflects the ability of the promoter mutants to activate transcription. Deletion of the sequence between $-$142 bp and $-$129 bp, relative to the start of transcription, resulted in an 8-fold decrease in CAT activity. Nuclear proteins from JEG-3, HeLa, and HepG2 (human liver cells), formed specific binding complexes with this region of the hPL$\sb3$ promoter, as shown by gel mobility shift assay. The $-$142 bp to $-$129 bp region contains a sequence similar to that of a variant binding site for the transcription factor Sp1. Sp1-like proteins were identified by DNA binding assay, in the nuclear extracts of the three cell lines. A series of G nucleotides in the hPL$\sb3$ promoter regulatory region were identified by methylation interference assay to interact with the DNA-binding proteins and the pattern obtained is similar to that for other Sp1 binding sites that have been studied. This suggests that hPL$\sb3$ may be transcriptionally regulated by Sp1 or a Sp1-like transacting factor. ^

Molecular characterization of a gene required for entry into S phase of the mitotic cell cycle in the yeast {\it Saccharomyces cerevisiae\/}

A strain of Saccaromyces cerevisiae (SC3B) with a temperature sensitive defect in the synthesis of DNA has been isolated. This defect is due to a single recessive mutation in a gene named INS1 required for the initiation of S phase. Arrested cells carrying the ins1$\sp{ts}$ allele are defective in the completion of G1 to S phase transition events including SPB duplication or separation, initiation of DNA synthesis, normal control of budding, and bud neck stability. The mutation and a gene which complements the mutation were mapped to chromosome IV. The complementing gene was proved to be the wild type allele of the temperature sensitive mutation by genetic linkage of an integrated clone. A very low abundance 4.2 kb RNA message was observed in the strain SC3B which increased greatly in this strain transformed with a multiple copy plasmid carrying the complementing clone. The wild type gene was sequenced and found to encode a 1268 amino acid protein of with a molecular weight of 142,655 Daltons. Computer assisted searches for similar DNA sequences revealed no significant homology matches. However, searches for protein sequence homology revealed a protein (the DIS3 gene product of S. pombe) with a similar sequence over a 534 amino acid stretch to the predicted INS1 gene product. A later search revealed a near identical sequence for a gene (SRK1) also isolated from S. cerevisiae. ^

The role of the amino terminus of Bacillus subtilis sigmaK in transcription initiation

The sigma (σ) subunit of eubacterial RNA polymerase (RNAP) is required for specific recognition of promoter DNA sequences and transcription initiation. Regulation of bacterial gene expression can be achieved by modulating a factor activity. The Bacillus subtilis sporulation a σ factor, σ K, controls gene expression of the late sporulation regulon. σ K is synthesized as an inactive precursor protein, pro-σ K, with a 20 amino acid pro sequence. Proteolytic processing of the pro sequence produces the active form, σK, which is able to bind to the core subunits of RNAP to direct gene expression. Thus, the pro sequence renders σK inactive in vivo. After processing, the amino terminus of σK consists of region 1.2, which is conserved among various σ factors. To understand the role of the amino terminus of σK, namely the pro sequence and region 1.2, mutagenesis of both regions was pursued. NH 2-terminal truncations of pro-σK were constructed to address how the pro sequence silences σK activity. The work described here shows that the pro sequence inhibits the ability of σ K to associate with the core subunits and that a deletion of only six amino acids of the pro sequence is sufficient to activate pro-σ K for DNA binding and transcription initiation to levels similar to σ K. Additionally, site directed mutagenesis was used to obtain single amino acid substitutions in region 1.2 to address the role of region 1.2 in σ K transcriptional activity. Two mutations were isolated, converting a lysine (K) to an alanine (A) at position three, and an asparagine (N) to a tyrosine (Y) at position five, both of which alter the efficiency of transcription initiation by RNAP containing the mutant σKs. Surprisingly, σ KK3A increased transcript production when compared to wild type. This increase is due to improvement in DNA affinity and increased stability of RNAP-DNA promoter open complexes. σKN5Y showed a decrease in transcription activity that is related to defects in the ability of RNAP to make the transition from the closed to open RNAP-DNA complex. Results of both the pro sequence and region 1.2 analyses indicate that the amino terminus of σK is important for transcription activity and this work adds to the increasing body of evidence that the amino termini of many σ factors modulate transcription initiation by RNAP. ^

PHENOTYPIC ASSOCIATION OF GENE AMPLIFICATION WITH MULTIPLE DRUG RESISTANCE IN VINCRISTINE RESISTANT CHINESE HAMSTER OVARY CELLS

Resistance of tumors to pharmacologic agents poses a significant problem in the treatment of human malignancies. This study overviews the scope of clinical resistance and focuses upon current research attempts toward investigation of the phenomenon of multidrug resistance (MDR).^ The objective of this investigation was to determine whether gene amplification had a role in the development of the MDR phenotype in Chinese hamster ovary cells (CHO) primarily selected for resistance to vincristine (VCR). A DNA fragment, previously shown to be amplified in two independently derived Chinese hamster cell lines exhibiting the MDR phenotype, was also amplified in VCR hamster lines. Sequences flanking this fragment were shown to contain coding information for a 4.3 kb transcript overproduced in VCR cells. These sequences were not enriched in double minute DNA preparations isolated from VCR cells. There was an approximately forty-fold increase in both the level of gene amplification and transcript overproduction in the VCR cell lines, independent of the level of primary resistance. This DNA amplification and overproduction of the 4.3 kb transcript was also demonstrated in CHO cells independently selected for resistance to Adriamycin and vinblastine.^ All the DNA sequences of two hamster cDNA clones containing 785 and 932 base pair inserts showed direct homology to the published mouse mdr sequences (about 90%). This sequence conservation held for only portions of the gene when the human mdr1 sequences were compared with those from either the mouse or hamster.^ Somatic cell hybrids, constructed between VCR CHO cells and sensitive murine cells, were used to determine whether there was a functional relationship between the chromosome bearing the amplified sequences and the MDR phenotype. Concordant segregation between vincristine resistance, the MDR phenotype, the presence of MDR-associated amplified sequences, overexpression of the mRNA encoded by these sequences, overexpression of the mRNA encoded by these sequences, and CHO chromosome Z1 was consistent with the hypothesis that there is an amplified gene on chromosome Z1 of the VCR CHO cells which is responsible for MDR in these cells. ^

Mycobacterium ulcerans persistence at a village water source of Buruli ulcer patients

Buruli ulcer (BU), a neglected tropical disease of the skin and subcutaneous tissue, is caused by Mycobacterium ulcerans and is the third most common mycobacterial disease after tuberculosis and leprosy. While there is a strong association of the occurrence of the disease with stagnant or slow flowing water bodies, the exact mode of transmission of BU is not clear. M. ulcerans has emerged from the environmental fish pathogen M. marinum by acquisition of a virulence plasmid encoding the enzymes required for the production of the cytotoxic macrolide toxin mycolactone, which is a key factor in the pathogenesis of BU. Comparative genomic studies have further shown extensive pseudogene formation and downsizing of the M. ulcerans genome, indicative for an adaptation to a more stable ecological niche. This has raised the question whether this pathogen is still present in water-associated environmental reservoirs. Here we show persistence of M. ulcerans specific DNA sequences over a period of more than two years at a water contact location of BU patients in an endemic village of Cameroon. At defined positions in a shallow water hole used by the villagers for washing and bathing, detritus remained consistently positive for M. ulcerans DNA. The observed mean real-time PCR Ct difference of 1.45 between the insertion sequences IS2606 and IS2404 indicated that lineage 3 M. ulcerans, which cause human disease, persisted in this environment after successful treatment of all local patients. Underwater decaying organic matter may therefore represent a reservoir of M. ulcerans for direct infection of skin lesions or vector-associated transmission.

Hierarchical self-assembly of nucleotide-appended oligopyrenotides into defined supramolecular objects

Supramolecular DNA assembly blends DNA building blocks with synthetic organic and inorganic molecules giving structural and functional advantages both to the initial self-assembly process and to the final construct. Synthetic molecules can bring a number of additional interactions into DNA nanotechnology. Incorporating extended aromatic molecules as connectors of DNA strands allows folding of these strands through π-π stacking (DNA “foldamers”). In previous work it was shown that short oligopyrenotides (phosphodiester-linked pyrene oligomers) behave as staircase-like foldamers, which cooperatively self-assemble into two-dimensional supramolecular polymers in aqueous medium. Herein, we demonstrate that a 10-mer DNA-sequence modified with 7 pyrene units (see illustration) forms dimensionally-defined supramolecular polymers under thermodynamic conditions in water. We present the self-assembly behavior, morphological studies, and the spectroscopic properties of the investigated DNA-sequences (illustrative AFM picture shown below).

Identification of Clostridium chauvoei in cultures and clinical material from blackleg using PCR.

An identification system for Clostridium chauvoei, using PCR amplification of the 16S rRNA gene (rrs) with specific oligonucleotide primers and subsequent restriction digestion of the amplification product is described. The specific oligonucleotide primers were designed based on the rrs gene sequences of C. chauvoei by comparing it to the DNA sequences of the rrs genes of its most closely related species Clostridium septicum and Clostridium carnis. A subsequent restriction digestion of the 960 bp amplification product was used in order to unambiguously identify C. chauvoei. The developed identification system was evaluated on clinical material during a recent outbreak of blackleg in cattle. Thereby, C. chauvoei was identified as the etiologic agent of the outbreak either directly from clinical samples of muscle, liver, spleen and kidney or from primary cultures made with this material. A comparison of the newly developed method with standard diagnostic tools for C. chauvoei showed that it has advantages over the immunofluorescence and is, therefore, a useful option to it. Moreover, the assay is a valuable tool for the phylogenetic identification of C. chauvoei which can assist to substitute the fastidious traditional identification methods and replace laboratory animal testing currently used.

A Method for Preparing Oligodeoxynucleotides Containing an Apurinic Site

10.1002/hlca.19900730309.abs In three steps, 2-deoxy-D-ribose has been converted into a phosphoramidite building block bearing a (t-Bu)Me2Si protecting group at the OH function of the anomeric centre of the furanose ring. This building block was subsequently incorporated into DNA oligomers of various base sequences using the standard phosphoramidite protocol for automated DNA synthesis. The resulting silyl-oligomers have been purified by HPLC and selectively desilylated to the corresponding free apurinic DNA sequences. The hexamer d (A-A-A-A-X-A) (X representing the apurinic site) which was prepared in this way was characterized by 1H- and 31P-NMR spectroscopy. The other sequences as well as their fragments, which formed upon treatment with alkali base, were analyzed by polyacrylamide gel electrophoresis.

Reclassification of Actinobacillus muris as Muribacter muris gen. nov. comb. nov.

To reinvestigate the taxonomy of [Actinobacillus] muris, 474 strains mainly from mice and rats were characterized by phenotype and 130 strains selected for genotypic characterization by 16S rRNA and partial rpoB gene sequencing. The type strain was further investigated by whole genome sequencing. Phylogenetic analysis of the DNA sequences showed one monophyletic group with intra group similarities of 96.7 % and 97.2 % for 16S rRNA and rpoB genes, respectively. The lowest 16S rRNA similarity to the closest related valid named taxon outside the group was 95.9 % to the type strain of [Pasteurella] pneumotropica. The closest related taxon based on rpoB sequence comparison was 'Haemophilus influenzae-murium' with 88.4 %. A new genus, Muribacter is proposed based on a distinct phylogenetic position based on 16S rRNA and rpoB gene sequence comparisons with major divergence to the existing genera of Pasteurellaceae. The new genus includes the characteristics of [Actinobacillus] muris with the emendation that acid formation from (-)-D-mannitol is variable as well the hydrolysis of esculin while the α-glucosidase test is positive. There is no requirement for exogenously supplied nicotinamide adenine dinucleotide (V factor) for the majority of strains investigated, however, one strain was found positive. The major fatty acids of the type strain of Muribacter muris were C 14:0, C 14:0 3OH/C 16:1 ISOI, C 16:1 ω7c and C 16:0 which is in line with most genera of Pasteurellaceae. The type strain of Muribacter muris is CCUG 16938T ( = NCTC 12432T = ATCC 49577T).

EXPRESSION OF THE HUMAN PLACENTAL LACTOGEN GENES

The placenta is the site of synthesis of various peptide and steroid hormones related to pregnancy. Human placental lactogen (hPL) is the predominant peptide hormone secreted by term placenta and its synthesis is tissue-specific and coupled to placenta development. The objective of this work was to study the structure and expression of the hPL.^ Poly(A('+))RNA from human term placenta was translated in a mouse-derived cell-free system. A major band corresponding to pre-hPL and a minor band comigrating with mature hPL, represent (TURN)15% of the total radioactively labeled proteins. Analysis of the poly(A('+))RNA showed a prominent band at approximately 860 nucleotides. A corresponding band was observed in Northern blots of total RNA, hybridized with {('32)P}-labeled recombinant plasmid containing a portion of hPL cDNA. Similar analyses of nuclear RNA showed at least four additional bands at 990, 1200, 1460 and 1760 nucleotides, respectively, which are likely precursors of hPL mRNA. Poly(A('+))RNA was used to construct a cDNA library, of which approximately 5% of the clones were found to hybridize to hPL DNA sequences. Heteroduplexes constructed between a clone containing a 815 bp hPL cDNA insert and a hPL genomic DNA clone revealed four small intervening sequences which can account for the lengths observed in hnRNA molecules.^ Recombinant plasmid HCS-pBR322 containing a 550 bp insert of a cDNA transcript of human placental lactogen (hPL) mRNA was ('3)H-labeled an hybridized in situ to human chromosome preparations. These experiments allowed assignment of the hPL and growth hormone (hGH) genes, which have over 90% nucleotide homology in their coding sequences, to band q22-24 of chromosome 17. A gene copy number experiment showed that both genes are present in (TURN)3 copies per haploid genome.^ Experiments were designed to determine if all members of the hPL gene cluster, consisting of four non-allelic genes, are transcribed in term placenta. Advantage was taken of differences in restriction endonuclease sites in the coding portions of the different hPL genes, to distinguish the putative cDNAs of the transcriptionally active genes. Two genes were found to be represented in the cDNA library and their cDNA transcripts were isolated and characterized. Three independent methods showed that their corresponding mRNAs are about equally represented in the hPL mRNA population. The two cDNAs code for prehPL proteins which differ at a single amino acid position. However the secreted hPLs have identical amino acid sequences. A tetramer insertion duplication was found in a palindrome area of the 3' untranslated region of one of the hPL mRNAs. ^

An analysis of the function of region 1.2 of the primary sigma factor, sigma 70, from Escherichia coli

The sigma (σ) subunit of eubacterial RNA polymerase is required for recognition of and transcription initiation from promoter DNA sequences. One family of sigma factors includes those related to the primary sigma factor from E. coli, σ70. Members of the σ70 family have four highly conserved domains, of which regions 2 through 4 are present in all members. Region 1 can be subdivided into regions 1.1 and 1.2. Region 1.1 affects DNA binding by σ 70 alone, as well as transcription initiation by holoenzyme. Region 1.2, present and highly conserved in most sigma factors, has not yet been assigned a putative function, although previous work demonstrated that it is not required for either association with the core subunits of RNA polymerase or promoter specific binding by holoenzyme. This study primarily investigates the functional role of region 1.2 during transcription initiation. In vivo and in vitro characterization of thirty-two single amino acid substitutions targeted to region 1.2 of E. coli σ70 as well as a deletion of region 1.2, revealed that mutations in region 1.2 can affect promoter binding, open complex formation, initiated complex formation, and the transition from abortive transcription to elongation. The relative degree of solvent exposure of several positions in region 1.2 has been determined, with positions 116 and 122 likely to be located near the surface of σ70. ^ During the course of this study, the existence of two “wild type” variants of E. coli σ70 was discovered. The identity of amino acid 149 has been reported variably as either arginine or aspartic acid in published articles and in online databases. In vivo and in vitro characterization of the two reported variations of E. coli σ70 (N149 and D149) has determined that the two variants are functionally equivalent. However, in vivo and in vitro characterization of single amino acid substitutions and a region 1.2 deletion in the context of each variant background revealed that the behavior of some mutations are greatly affected by the identity of amino acid 149. ^

Targeted Deletion Of Functionally Validated Enhancers Defines Their Role in Mouse Limb Development

Transcriptional enhancers are genomic DNA sequences that contain clustered transcription factor (TF) binding sites. When combinations of TFs bind to enhancer sequences they act together with basal transcriptional machinery to regulate the timing, location and quantity of gene transcription. Elucidating the genetic mechanisms responsible for differential gene expression, including the role of enhancers, during embryological and postnatal development is essential to an understanding of evolutionary processes and disease etiology. Numerous methods are in use to identify and characterize enhancers. Several high-throughput methods generate large datasets of enhancer sequences with putative roles in embryonic development. However, few enhancers have been deleted from the genome to determine their roles in the development of specific structures, such as the limb. Manipulation of enhancers at their endogenous loci, such as the deletion of such elements, leads to a better understanding of the regulatory interactions, rules and complexities that contribute to faithful and variant gene transcription – the molecular genetic substrate of evolution and disease. To understand the endogenous roles of two distinct enhancers known to be active in the mouse embryo limb bud we deleted them from the mouse genome. I hypothesized that deletion of these enhancers would lead to aberrant limb development. The enhancers were selected because of their association with p300, a protein associated with active transcription, and because the human enhancer sequences drive distinct lacZ expression patterns in limb buds of embryonic day (E) 11.5 transgenic mice. To confirm that the orthologous mouse enhancers, mouse 280 and 1442 (M280 and M1442, respectively), regulate expression in the developing limb we generated stable transgenic lines, and examined lacZ expression. In M280-lacZ mice, expression was detected in E11.5 fore- and hindlimbs in a region that corresponds to digits II-IV. M1442-lacZ mice exhibited lacZ expression in posterior and anterior margins of the fore- and hindlimbs that overlapped with digits I and V and several wrist bones. We generated mice lacking the M280 and M1442 enhancers by gene targeting. Intercrosses between M280 -/+ and M1442 -/+, respectively, generated M280 and M1442 null mice, which are born at expected Mendelian ratios and manifest no gross limb malformations. Quantitative real-time PCR of mutant E11.5 limb buds indicated that significant changes in transcriptional output of enhancer-proximal genes accompanied the deletion of both M280 and M1442. In neonatal null mice we observed that all limb bones are present in their expected positions, an observation also confirmed by histology of E18.5 distal limbs. Fine-scale measurement of E18.5 digit bone lengths found no differences between mutant and control embryos. Furthermore, when the developmental progression of cartilaginous elements was analyzed in M280 and M1442 embryos from E13.5-E15.5, transient development defects were not detected. These results demonstrate that M280 and M1442 are not required for mouse limb development. Though M280 is not required for embryonic limb development it is required for the development and/or maintenance of body size – adult M280 mice are significantly smaller than control littermates. These studies highlight the importance of experiments that manipulate enhancers in situ to understand their contribution to development.

{\it cis\/} -acting elements and {\it trans\/} -acting factors that control serum amyloid A gene expression during inflammation

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Molecular analysis of a neurovirulent murine leukemia virus, {\it ts\/}1

ts1 is a neurovirulent spontaneous temperature-sensitive mutant of Moloney murine leukemia virus TB (MoMuLV-TB). MoMuLV-TB causes T-cell lymphoma or lymphoid leukemia in mice after a long latency period whereas ts1 causes a progressive hindlimb paralytic disease after a much shorter latency period. In previous studies, it had been shown that the temperature-sensitive defect resided in the $env$ gene. At the restrictive temperature, the envelope precursor polyprotein, gPr80$\sp{env}$, is inefficiently processed intracellularly into a heterodimer consisting of two cleavage products, gp70 and Prp15E. This inefficient processing is correlated with neurovirulence. In this study, the nucleotide sequences of the env genes for both ts1 and MoMuLV-TB were determined, and the encoded amino acid sequences were deduced from the DNA sequences. There were four unique amino acid substitutions in the gPr80$\sp{env}$ of ts1. In order to determine which unique amino acid was responsible for the phenotypic characteristics of ts1, a set of hybrid genomes was constructed by exchanging restriction fragments between ts1 and MoMuLV-TB. NIH 3T3 cells were transfected with the hybrid genomes to obtain infectious hybrid viruses. Assays of the hybrid viruses showed that a Val-25$\to$Ile substitution in gPr80$\sp{env}$ was responsible for the temperature sensitivity, inefficient processing, and neurovirulence of ts1. In further studies, the Ile-25 in gPr80$\sp{env}$ was substituted with Thr, Ala, Leu, Gly, and Glu by site-directed mutagenesis to generate a new set of mutant viruses, i.e., ts1-T, -A, -L, -G, and -E, respectively. The rank order of the mutants for temperature sensitivity was: ts1-E $>$ ts1-G $>$ ts1-L $>$ ts1-A $>$ ts1 $>$ ts1-T. The degree of temperature sensitivity of each of the mutants also correlated with the degree of inefficient processing of gPr80$\sp{env}$. The mutant viruses were assayed for neurovirulence. ts1-T caused whole body tremor, ts1-A caused hindlimb paralysis, ts1-L caused paraparesis, but ts1-G and -E were not neurovirulent. These results show that inefficient processing of gPr80$\sp{env}$ is correlated with neurovirulence, but if processing of gPr80$\sp{env}$ is too inefficient there is no neurovirulence. Furthermore, the disease profile of each of the neurovirulent viruses depends on the degree of inefficient processing of gPr80$\sp{env}$. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^