979 resultados para Cardiovascular agents.


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Animals have long been noted for their ability to moderate cardiovascular responses to stress. To date, however, little attention has been directed towards the ability of videotapes of animals to buffer people from challenges. This study thus explored the effect of five video conditions (fish, bird, primate, control 1 [humans], control 2 [blank screen]) on the heart rate and blood pressure of 100 volunteers before and after exposure to a cognitive stressor. Twenty participants were randomly assigned to each of the video conditions. Both the heart rate and blood pressure (diastolic and systolic) of the participants were recorded after a 10 minute period of relaxation (phase 1), following 10 minutes of exposure to the appropriate video for that condition (phase 2) and again, following a 10 minute period of reading aloud, i.e. a cognitive stressor (phase 3). The videos encouraged relaxation, with participants in all conditions exhibiting significantly (p < 0.001) lower levels of heart rate and blood pressure in phase 2 than phases 1 or 3. Individuals exposed to the videos of birds, fish and primates showing significantly (p < 0.001) lower levels of heart rate and blood pressure in phase 3 than individuals exposed to the control videos. It is concluded that videotapes of certain animals can reduce cardiovascular responses to psychological stress and may help to buffer viewers from anxiety, at least in the short term.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: This study investigated whether differences exist in atherogen-induced migratory behaviors and basal antioxidant enzyme capacity of vascular smooth muscle cells (VSMC) from human coronary (CA) and internal mammary (IMA) arteries. Methods: Migration experiments were performed using the Dunn chemotaxis chamber. The prooxidant [NAD(P)H oxidase] and antioxidant [NOS, superoxide dismutase, catalase and glutathione peroxidase] enzyme activities were determined by specific assays. Results: Chemotaxis experiments revealed that while both sets of VSMC migrated towards platelet-derived growth factor-BB (1-50 ng/ml) and angiotensin II (1-50 nM), neither oxidized-LDL (ox-LDL, 25-100 ng/ml) nor native LDL (100 ng/ml) affected chemotaxis in IMA VSMC. However, high dose ox-LDL produced significant chemotaxis in CAVSMC that was inhibited by pravastatin (100 nM), mevastatin (10 nM), losartan (10 nM), enalapril (1 micro.M), and MnTBAP (a free radical scavenger, 50 micro.M). Microinjection experiments with isoprenoids i.e. geranylgeranylpyrophosphate (GGPP) and farnesylpyrophosphate (FPP) showed distinct involvement of small GTPases in atherogeninduced VSMC migration. Significant increases in antioxidant enzyme activities and nitrite production along with marked decreases in NAD(P)H oxidase activity and superoxide levels were determined in IMA versus CA VSMC. Conclusions: Enhanced intrinsic antioxidant capacity may confer on IMAVSMC resistance to migration against atherogenic agents. Drugs that regulate ox-LDL or angiotensin II levels also exert antimigratory effects.