Developmentally related responses of maize catalase genes to salicylic acid.

The response of the maize catalase genes (Cat1, Cat2, and Cat3) to salicylic acid (SA) was examined at two distinct developmental stages: embryogenesis and germination. A unique, germination-related differential response of each maize catalase gene to various doses of SA was observed. During late embryogenesis, total catalase activity in scutella increased dramatically with 1 mM SA treatment. The accumulation of Cat2 transcript and CAT-2 isozyme protein provided the major contribution to the observed increase in total catalase activity. This increase was paralleled by the enhanced growth of germinated embryos at that stage. In a CAT-2 null mutant line, a full compensation of total catalase activity by the CAT-1 isozyme was observed in the presence of SA. This suggests that catalase is important for maintenance of normal cellular processes under stress conditions. SA at 1 mM, which enhances growth of precociously germinated embryos, appeared to inhibit seed germination at 1 day after inhibition. Furthermore, Cat2 transcript accumulation was inhibited at this stage. SA is probably not a direct signal for the induction of the catalase genes. Other signals, possibly germination-related regulator(s), might be responsible for the induction of the catalase genes. The effect of SA on the activity of purified catalase protein was also examined.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Expression profiling and sequence diversity of novel DREB genes from common bean (Phaseolus vulgaris L.) and their association with drought-related traits

Common bean is a major dietary component in several countries, but its productivity is negatively affected by abiotic stresses. Dissecting candidate genes involved in abiotic stress tolerance is a paramount step toward the improvement of common bean performance under such constraints. Thereby, this thesis presents a systematic analysis of the DEHYDRATION RESPONSIVE ELEMENT-BINDING (DREB) gene subfamily, which encompasses genes that regulate several processes during stress responses, but with limited information for common bean. First, a series of in silico analyses with sequences retrieved from the P. vulgaris genome on Phytozome supported the categorization of 54 putative PvDREB genes distributed within six phylogenetic subgroups (A-1 to A-6), along the 11 chromosomes. Second, we cloned four novel PvDREB genes and determined their inducibility-factors, including the dehydration-, salinity- and cold-inducible genes PvDREB1F and PvDREB5A, and the dehydration- and cold-inducible genes PvDREB2A and PvDREB6B. Afterwards, nucleotide polymorphisms were searched through Sanger sequencing along those genes, revealing a high number of single nucleotide polymorphisms within PvDREB6B by the comparison of Mesoamerican and Andean genotypes. The nomenclature of PvDREB6B is discussed in details. Furthermore, we used the BARCBean6K_3 SNP platform to identify and genotype the closest SNP to each one of the 54 PvDREB genes. We selected PvDREB6B for a broader study encompassing a collection of wild common bean accessions of Mesoamerican origin. The population structure of the wild beans was accessed using sequence polymorphisms of PvDREB6B. The genetic clusters were partially associated with variation in latitude, altitude, precipitation and temperature throughout the areas such beans are distributed. With an emphasis on drought stress, an adapted tube-screening method in greenhouse conditions enabled the phenotyping of several drought-related traits in the wild collection. Interestingly, our data revealed a correlation between root depth, plant height and biomass and the environmental data of the location of the accessions. Correlation was also observed between the population structure determined through PvDREB6B and the environmental data. An association study combining data from the SNP array and DREB polymorphisms enabled the detection of SNP associated with drought-related traits through a compressed mixed linear model (CMLM) analysis. This thesis highlighted important features of DREB genes in common bean, revealing candidates for further strategies aimed at improvement of abiotic stress tolerance, with emphasis on drought tolerance

RNA-Seq expression profile of genes related to neurodegenerative disorders affecting the human retina

Human neurodegenerative diseases, such as Parkinson’s disease (PD) and the neuromuscular disorders called dystroglycanopathies (DGPs), cause retinal impairments. We have used RNA-Seq technology to catalog all known genes linked to PD and DGPs expressed in the human retina and quantitate their mRNA levels in terms of FPKM. We have also characterized their expression profiles in the retina by determining their exonic, intronic and exon-intron junction expression levels, as well as the alternative splicing pattern of particular genes. We believe these data could pave the way toward understanding the molecular bases of sight deficiencies associated with neurodegenerative disorders.

Neurospora crassa transcriptomics reveals oxidative stress and plasma membrane homeostasis biology genes as key targets in response to chitosan

Chitosan is a natural polymer with antimicrobial activity. Chitosan causes plasma membrane permeabilization and induction of intracellular reactive oxygen species (ROS) in Neurospora crassa. We have determined the transcriptional profile of N. crassa to chitosan and identified the main gene targets involved in the cellular response to this compound. Global network analyses showed membrane, transport and oxidoreductase activity as key nodes affected by chitosan. Activation of oxidative metabolism indicates the importance of ROS and cell energy together with plasma membrane homeostasis in N. crassa response to chitosan. Deletion strain analysis of chitosan susceptibility pointed NCU03639 encoding a class 3 lipase, involved in plasma membrane repair by lipid replacement, and NCU04537 a MFS monosaccharide transporter related to assimilation of simple sugars, as main gene targets of chitosan. NCU10521, a glutathione S-transferase-4 involved in the generation of reducing power for scavenging intracellular ROS is also a determinant chitosan gene target. Ca2+ increased tolerance to chitosan in N. crassa. Growth of NCU10610 (fig 1 domain) and SYT1 (a synaptotagmin) deletion strains was significantly increased by Ca2+ in the presence of chitosan. Both genes play a determinant role in N. crassa membrane homeostasis. Our results are of paramount importance for developing chitosan as an antifungal.

Osteopontin and related SIBLING glycoprotein genes are expressed by sertoli cells during mouse testis development

Matrix proteins play important roles in tissue morphogenesis. We have studied the expression of genes encoding the related SIBLING glycoproteins osteopontin (OPN), bone sialoprotein (BSP), and dentin matrix protein (DMP) during the development of male and female gonads during mouse embryogenesis. Opn mRNA was expressed specifically by Sertoli cells of the developing testis cords, in the mesonephric tubules of both sexes, and, transiently, in the Mullerian ducts of both sexes, as determined by whole-mount and section in situ hybridization. OPN protein was detected in the cytoplasm of Sertoli cells and luminal cells of the mesonephric tubules, with small amounts associated with the plasma membrane of germ cells. We found no defects in developing testes of Opn-/- mice using a range of cell type-specific markers, suggesting that other SIBLING proteins may function in testis development. Dmp and Bsp mRNA was also expressed in the developing testis cords, supporting the view that all three SIBLING proteins may contribute to testis differentiation. (c) 2005 Wiley-Liss, Inc.

Identification and analysis of venom gland-specific genes from the coastal taipan (Oxyuranus scutellatus) and related species

Australian terrestrial elapid snakes contain amongst the most potently toxic venoms known. However, despite the well-documented clinical effects of snake bite, little research has focussed on individual venom components at the molecular level. To further characterise the components of Australian elapid venoms, a complementary (cDNA) microarray was produced from the venom gland of the coastal taipan (Oxyuranus scutellatus) and subsequently screened for venom gland-specific transcripts. A number of putative toxin genes were identified, including neurotoxins, phospholipases, a pseudechetoxin-like gene, a venom natriuretic peptide and a nerve growth factor together with other genes involved in cellular maintenance. Venom gland-specific components also included a calglandulin-like protein implicated in the secretion of toxins from the gland into the venom. These toxin transcripts were subsequently identified in seven other related snake species, producing a detailed comparative analysis at the cDNA and protein levels. This study represents the most detailed description to date of the cloning and characterisation of different genes associated with envenomation from Australian snakes.

Transcriptome-Wide Mapping of Pea Seed Ageing Reveals a Pivotal Role for Genes Related to Oxidative Stress and Programmed Cell Death

Understanding of seed ageing, which leads to viability loss during storage, is vital for ex situ plant conservation and agriculture alike. Yet the potential for regulation at the transcriptional level has not been fully investigated. Here, we studied the relationship between seed viability, gene expression and glutathione redox status during artificial ageing of pea (Pisum sativum) seeds. Transcriptome-wide analysis using microarrays was complemented with qRT-PCR analysis of selected genes and a multilevel analysis of the antioxidant glutathione. Partial degradation of DNA and RNA occurred from the onset of artificial ageing at 60% RH and 50 degrees C, and transcriptome profiling showed that the expression of genes associated with programmed cell death, oxidative stress and protein ubiquitination were altered prior to any sign of viability loss. After 25 days of ageing viability started to decline in conjunction with progressively oxidising cellular conditions, as indicated by a shift of the glutathione redox state towards more positive values (>-190 mV). The unravelling of the molecular basis of seed ageing revealed that transcriptome reprogramming is a key component of the ageing process, which influences the progression of programmed cell death and decline in antioxidant capacity that ultimately lead to seed viability loss.

Plant Genes Related to Gibberellin Biosynthesis and Signaling Are Differentially Regulated during the Early Stages of AM Fungal Interactions

Dear Editor, Phytohormones are essential regulators of plant development, but their role in the signaling processes between plants and fungi during arbuscular mycorrhizal (AM) establishment is far from being understood (Ludwig-Müller, 2010). AM colonization leads to extensive effects on host metabolism, as revealed by transcriptome studies of AM plants (Hogekamp et al., 2011). Some genes have been specified as an AM core set, since they are mycorrhizal-responsive, irrespective of the identity of the plant, of the fungus, and of the investigated organ. These data support the idea that, on colonization, plants activate a wide reprogramming of their major regulatory networks and argue that mobile factors of fungal or plant origin are involved in such generalized metabolic changes. In this context, hormones may be good candidates (Bonfante and Genre, 2010). However, the emerging picture of the interaction between phytohormones and AMs is very patchy, and information on gibberellin (GA) involvement is still more limited (García-Garrido et al., 2010). The role of GA during nodulation is instead known to control the nodulation signaling pathway (Ferguson et al., 2011).

Expression of rice genes homologous of Arabidopsis genes previously related to drought tolerance.

The identification and validation of candidate genes related to traits of interest is a time consuming and expensive process and the homology among genes from different species can facilitate the identification of genes of the target species from the genomic information of a model species. This study aimed to quantify the expression of homologous rice genes previously related to drought tolerance in Arabidopsis. Five genes (CPK6, PLDa, GluR2, CesA8, and EIN2) were identified in rice by the homology of the amino acid sequence between rice and Arabidopsis. The genotypes Douradão (drought tolerant) and Primavera (drought susceptible) were subjected to a water deficit experiment, and subsequently evaluated for gene expression by qPCR for the five homologous and Lsi1 genes. The qPCR analysis clearly showed that the five homologous genes were expressed in rice, which is an indication that these genes could preserve their function in rice as a response to drought. In Douradão, of the five homologous genes, all but OsGluR2 displayed an increase in the average expression in drought treatment when compared to the control, while in Primavera, the average expression of the five genes did not differ between the control and drought treatment. In Douradão, the OsPLDa1, which showed the higher expression level in drought in relation to the control (10.82), significantly increased the gene expression in the leaf and root tissues as a response to drought, in both vegetative and reproductive stages, whereas in Primavera, this gene was suppressed in both tissues and stages under drought. Therefore, the OsPLDa1 gene was the most important in relation to drought response and is an interesting candidate for further studies in developing rice cultivars that are more tolerant to this stress.

Error, Bias, and Long-Branch Attraction in Data for Two Chloroplast Photosystem Genes in Seed Plants

Sequences of two chloroplast photosystem genes, psaA and psbB, together comprising about 3,500 bp, were obtained for all five major groups of extant seed plants and several outgroups among other vascular plants. Strongly supported, but significantly conflicting, phylogenetic signals were obtained in parsimony analyses from partitions of the data into first and second codon positions versus third positions. In the former, both genes agreed on a monophyletic gymnosperms, with Gnetales closely related to certain conifers. In the latter, Gnetales are inferred to be the sister group of all other seed plants, with gymnosperms paraphyletic. None of the data supported the modern ‘‘anthophyte hypothesis,’’ which places Gnetales as the sister group of flowering plants. A series of simulation studies were undertaken to examine the error rate for parsimony inference. Three kinds of errors were examined: random error, systematic bias (both properties of finite data sets), and statistical inconsistency owing to long-branch attraction (an asymptotic property). Parsimony reconstructions were extremely biased for third-position data for psbB. Regardless of the true underlying tree, a tree in which Gnetales are sister to all other seed plants was likely to be reconstructed for these data. None of the combinations of genes or partitions permits the anthophyte tree to be reconstructed with high probability. Simulations of progressively larger data sets indicate the existence of long-branch attraction (statistical inconsistency) for third-position psbB data if either the anthophyte tree or the gymnosperm tree is correct. This is also true for the anthophyte tree using either psaA third positions or psbB first and second positions. A factor contributing to bias and inconsistency is extremely short branches at the base of the seed plant radiation, coupled with extremely high rates in Gnetales and nonseed plant outgroups. M. J. Sanderson,* M. F. Wojciechowski,*† J.-M. Hu,* T. Sher Khan,* and S. G. Brady

Kallikrein-related peptidase 4 activation of protease-activated receptor family members and association with prostate cancer

Two areas of particular importance in prostate cancer progression are primary tumour development and metastasis. These processes involve a number of physiological events, the mediators of which are still being discovered and characterised. Serine proteases have been shown to play a major role in cancer invasion and metastasis. The recently discovered phenomenon of their activation of a receptor family known as the protease activated receptors (PARs) has extended their physiological role to that of signaling molecule. Several serine proteases are expressed by malignant prostate cancer cells, including members of the kallikreinrelated peptidase (KLK) serine protease family, and increasingly these are being shown to be associated with prostate cancer progression. KLK4 is highly expressed in the prostate and expression levels increase during prostate cancer progression. Critically, recent studies have implicated KLK4 in processes associated with cancer. For example, the ectopic over-expression of KLK4 in prostate cancer cell lines results in an increased ability of these cells to form colonies, proliferate and migrate. In addition, it has been demonstrated that KLK4 is a potential mediator of cellular interactions between prostate cancer cells and osteoblasts (bone forming cells). The ability of KLK4 to influence cellular behaviour is believed to be through the selective cleavage of specific substrates. Identification of relevant in vivo substrates of KLK4 is critical to understanding the pathophysiological roles of this enzyme. Significantly, recent reports have demonstrated that several members of the KLK family are able to activate PARs. The PARs are relatively new members of the seven transmembrane domain containing G protein coupled receptor (GPCR) family. PARs are activated through proteolytic cleavage of their N-terminus by serine proteases, the resulting nascent N-terminal binds intramolecularly to initiate receptor activation. PARs are involved in a number of patho-physiological processes, including vascular repair and inflammation, and a growing body of evidence suggests roles in cancer. While expression of PAR family members has been documented in several types of cancers, including prostate, the role of these GPCRs in prostate cancer development and progression is yet to be examined. Interestingly, several studies have suggested potential roles in cellular invasion through the induction of cytoskeletal reorganisation and expression of basement membrane-degrading enzymes. Accordingly, this program of research focussed on the activation of the PARs by the prostate cancer associated enzyme KLK4, cellular processing of activated PARs and the expression pattern of receptor and agonist in prostate cancer. For these studies KLK4 was purified from the conditioned media of stably transfected Sf9 insect cells expressing a construct containing the complete human KLK4 coding sequence in frame with a V5 epitope and poly-histidine encoding sequences. The first aspect of this study was the further characterisation of this recombinant zymogen form of KLK4. The recombinant KLK4 zymogen was demonstrated to be activatable by the metalloendopeptidase thermolysin and amino terminal sequencing indicated that thermolysin activated KLK4 had the predicted N-terminus of mature active KLK4 (31IINED). Critically, removal of the pro-region successfully generated a catalytically active enzyme, with comparable activity to a previously published recombinant KLK4 produced from S2 insect cells. The second aspect of this study was the activation of the PARs by KLK4 and the initiation of signal transduction. This study demonstrated that KLK4 can activate PAR-1 and PAR-2 to mobilise intracellular Ca2+, but failed to activate PAR-4. Further, KLK4 activated PAR-1 and PAR-2 over distinct concentration ranges, with KLK4 activation and mobilisation of Ca2+ demonstrating higher efficacy through PAR-2. Thus, the remainder of this study focussed on PAR-2. KLK4 was demonstrated to directly cleave a synthetic peptide that mimicked the PAR-2 Nterminal activation sequence. Further, KLK4 mediated Ca2+ mobilisation through PAR-2 was accompanied by the initiation of the extra-cellular regulated kinase (ERK) cascade. The specificity of intracellular signaling mediated through PAR-2 by KLK4 activation was demonstrated by siRNA mediated protein depletion, with a reduction in PAR-2 protein levels correlating to a reduction in KLK4 mediated Ca2+mobilisation and ERK phosphorylation. The third aspect of this study examined cellular processing of KLK4 activated PAR- 2 in a prostate cancer cell line. PAR-2 was demonstrated to be expressed by five prostate derived cell lines including the prostate cancer cell line PC-3. It was also demonstrated by flow cytometry and confocal microscopy analyses that activation of PC-3 cell surface PAR-2 by KLK4 leads to internalisation of this receptor in a time dependent manner. Critically, in vivo relevance of the interaction between KLK4 and PAR-2 was established by the observation of the co-expression of receptor and agonist in primary prostate cancer and prostate cancer bone lesion samples by immunohistochemical analysis. Based on the results of this study a number of exciting future studies have been proposed, including, delineating differences in KLK4 cellular signaling via PAR-1 and PAR-2 and the role of PAR-1 and PAR-2 activation by KLK4 in prostate cancer cells and bone cells in prostate cancer progression.

Crosstalk between developmental and tumour-specific signalling pathways : kallikrein-related serine peptidases and nodal in prostrate cancer

Prostate cancer is an important male health issue. The strategies used to diagnose and treat prostate cancer underscore the cell and molecular interactions that promote disease progression. Prostate cancer is histologically defined by increasingly undifferentiated tumour cells and therapeutically targeted by androgen ablation. Even as the normal glandular architecture of the adult prostate is lost, prostate cancer cells remain dependent on the androgen receptor (AR) for growth and survival. This project focused on androgen-regulated gene expression, altered cellular differentiation, and the nexus between these two concepts. The AR controls prostate development, homeostasis and cancer progression by regulating the expression of downstream genes. Kallikrein-related serine peptidases are prominent transcriptional targets of AR in the adult prostate. Kallikrein 3 (KLK3), which is commonly referred to as prostate-specific antigen, is the current serum biomarker for prostate cancer. Other kallikreins are potential adjunct biomarkers. As secreted proteases, kallikreins act through enzyme cascades that may modulate the prostate cancer microenvironment. Both as a panel of biomarkers and cascade of proteases, the roles of kallikreins are interconnected. Yet the expression and regulation of different kallikreins in prostate cancer has not been compared. In this study, a spectrum of prostate cell lines was used to evaluate the expression profile of all 15 members of the kallikrein family. A cluster of genes was co-ordinately expressed in androgenresponsive cell lines. This group of kallikreins included KLK2, 3, 4 and 15, which are located adjacent to one another at the centromeric end of the kallikrein locus. KLK14 was also of interest, because it was ubiquitously expressed among the prostate cell lines. Immunohistochemistry showed that these 5 kallikreins are co-expressed in benign and malignant prostate tissue. The androgen-regulated expression of KLK2 and KLK3 is well-characterised, but has not been compared with other kallikreins. Therefore, KLK2, 3, 4, 14 and 15 expression were all measured in time course and dose response experiments with androgens, AR-antagonist treatments, hormone deprivation experiments and cells transfected with AR siRNA. Collectively, these experiments demonstrated that prostatic kallikreins are specifically and directly regulated by the AR. The data also revealed that kallikrein genes are differentially regulated by androgens; KLK2 and KLK3 were strongly up-regulated, KLK4 and KLK15 were modestly up-regulated, and KLK14 was repressed. Notably, KLK14 is located at the telomeric end of the kallikrein locus, far away from the centromeric cluster of kallikreins that are stimulated by androgens. These results show that the expression of KLK2, 3, 4, 14 and 15 is maintained in prostate cancer, but that these genes exhibit different responses to androgens. This makes the kallikrein locus an ideal model to investigate AR signalling. The increasingly dedifferentiated phenotype of aggressive prostate cancer cells is accompanied by the re-expression of signalling molecules that are usually expressed during embryogenesis and foetal tissue development. The Wnt pathway is one developmental cascade that is reactivated in prostate cancer. The canonical Wnt cascade regulates the intracellular levels of β-catenin, a potent transcriptional co-activator of T-cell factor (TCF) transcription factors. Notably, β-catenin can also bind to the AR and synergistically stimulate androgen-mediated gene expression. This is at the expense of typical Wnt/TCF target genes, because the AR:β-catenin and TCF:β-catenin interactions are mutually exclusive. The effect of β-catenin on kallikrein expression was examined to further investigate the role of β-catenin in prostate cancer. Stable knockdown of β-catenin in LNCaP prostate cancer cells attenuated the androgen-regulated expression of KLK2, 3, 4 and 15, but not KLK14. To test whether KLK14 is instead a TCF:β-catenin target gene, the endogenous levels of β-catenin were increased by inhibiting its degradation. Although KLK14 expression was up-regulated by these treatments, siRNA knockdown of β-catenin demonstrated that this effect was independent of β-catenin. These results show that β-catenin is required for maximal expression of KLK2, 3, 4 and 15, but not KLK14. Developmental cells and tumour cells express a similar repertoire of signalling molecules, which means that these different cell types are responsive to one another. Previous reports have shown that stem cells and foetal tissues can reprogram aggressive cancer cells to less aggressive phenotypes by restoring the balance to developmental signalling pathways that are highly dysregulated in cancer. To investigate this phenomenon in prostate cancer, DU145 and PC-3 prostate cancer cells were cultured on matrices pre-conditioned with human embryonic stem cells (hESCs). Soft agar assays showed that prostate cancer cells exposed to hESC conditioned matrices had reduced clonogenicity compared with cells harvested from control matrices. A recent study demonstrated that this effect was partially due to hESC-derived Lefty, an antagonist of Nodal. A member of the transforming growth factor β (TGFβ) superfamily, Nodal regulates embryogenesis and is re-expressed in cancer. The role of Nodal in prostate cancer has not previously been reported. Therefore, the expression and function of the Nodal signalling pathway in prostate cancer was investigated. Western blots confirmed that Nodal is expressed in DU145 and PC-3 cells. Immunohistochemistry revealed greater expression of Nodal in malignant versus benign glands. Notably, the Nodal inhibitor, Lefty, was not expressed at the mRNA level in any prostate cell lines tested. The Nodal signalling pathway is functionally active in prostate cancer cells. Recombinant Nodal treatments triggered downstream phosphorylation of Smad2 in DU145 and LNCaP cells, and stably-transfected Nodal increased the clonogencity of LNCaP cells. Nodal was also found to modulate AR signalling. Nodal reduced the activity of an androgen-regulated KLK3 promoter construct in luciferase assays and attenuated the endogenous expression of AR target genes including prostatic kallikreins. These results demonstrate that Nodal is a novel example of a developmental signalling molecule that is reexpressed in prostate cancer and may have a functional role in prostate cancer progression. In summary, this project clarifies the role of androgens and changing cellular differentiation in prostate cancer by characterising the expression and function of the downstream genes encoding kallikrein-related serine proteases and Nodal. Furthermore, this study emphasises the similarities between prostate cancer and early development, and the crosstalk between developmental signalling pathways and the AR axis. The outcomes of this project also affirm the utility of the kallikrein locus as a model system to monitor tumour progression and the phenotype of prostate cancer cells.

Persons with age-related maculopathy risk genotypes and clinically normal eyes have reduced mesopic vision

PURPOSE: To determine if participants with normal visual acuity, no ophthalmoscopically signs of age-related maculopathy (ARM) in both eyes and who are carriers of the CFH, LOC387715 and HRTA1 high-risk genotypes (“gene-positive”) have impaired rod- and cone-mediated mesopic visual function compared to persons who do not carry the risk genotypes (“gene-negative”).---------- METHODS: Fifty-three Caucasian study participants (mean 55.8 ± 6.1) were genotyped for CFH, LOC387715/ARMS2 and HRTA1 polymorphisms. We genotyped single nucleotide polymorphisms (SNPs) in the CFH (rs380390), LOC387715/ARMS2 (rs10490924) and HTRA1 (rs11200638) genes using Applied Biosystems optimised TaqMan assays. We determined the critical fusion frequency (CFF) mediated by cones alone (Long, Middle and Short wavelength sensitive cones; LMS) and by the combined activities of cones and rods (LMSR). The stimuli were generated using a 4-primary photostimulator that provides independent control of the photoreceptor excitation under mesopic light levels. Visual function was further assessed using standard clinical tests, flicker perimetry and microperimetry.---------- RESULTS: The mesopic CFF mediated by rods and cones (LMSR) was significantly reduced in gene-positive compared to gene-negative participants after correction for age (p=0.03). Cone-mediated CFF (LMS) was not significantly different between gene-positive and -negative participants. There were no significant associations between flicker perimetry and microperimetry and genotype.---------- CONCLUSIONS: This is the first study to relate ARM risk genotypes with mesopic visual function in clinically normal persons. These preliminary results could become of clinical importance as mesopic vision may be used to document sub-clinical retinal changes in persons with risk genotypes and to determine whether those persons progress into manifest disease.